Prupe.4G226200_v2.0.a1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
OG0000866
Physical Location & Seq
Forward (+)
14369672 .. 14373454
3783 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G226200.1

Sequence Viewer

Length: 234 bp
ATGGCATCATCCTCCAAGACTTTTCTTCTTCTTGGCTTTATGTTTGCTCTTGTGATCCTCATCTCCTCTGAGGTCTCAGCTCGTGAGCTAGTGGAAATTACGAAGCCAGCAACCTATATTGGTTGCTTCTGCTTTCAAGAGATGCAATGGGCTTCCCAGCTTCCTCCCTCTATGGTGCTTCTACTTTCAAGAGATGGTCTTCTAGGCCCCCTTGGTGATCTTTTTTCATGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

78

Amino Acids

8.42

Weight (kDa)

4.66

Isoelectric Point (pI)

45.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 49
AgsI TTSAA 2 cut(s) 137, 189
AluBI AGCT 3 cut(s) 80, 88, 160
AluI AGCT 3 cut(s) 80, 88, 160
Alw26I GTCTC 1 cut(s) 79
AlwI GGATC 1 cut(s) 49
AoxI GGCC 1 cut(s) 205
AspS9I GGNCC 1 cut(s) 206
AsuHPI GGTGA 1 cut(s) 227
BauI CACGAG 1 cut(s) 81
BbsI GAAGAC 1 cut(s) 191
BccI CCATC 1 cut(s) 188
BcoDI GTCTC 1 cut(s) 79
BfaI CTAG 2 cut(s) 89, 203
BmgT120I GGNCC 1 cut(s) 206
BmiI GGNNCC 1 cut(s) 208
BmsI GCATC 2 cut(s) 14, 132
BpiI GAAGAC 1 cut(s) 191
BsaBI GATNNNNATC 1 cut(s) 59
BsaI GGTCTC 1 cut(s) 79
BsaJI CCNNGG 1 cut(s) 211
Bse3DI GCAATG 1 cut(s) 152
Bse8I GATNNNNATC 1 cut(s) 59
BseDI CCNNGG 1 cut(s) 211
BseGI GGATG 1 cut(s) 8
BseJI GATNNNNATC 1 cut(s) 59
BseMI GCAATG 1 cut(s) 152
BseMII CTCAG 2 cut(s) 60, 90
BseRI GAGGAG 1 cut(s) 55
BseYI CCCAGC 1 cut(s) 156
BshFI GGCC 1 cut(s) 207
BsmAI GTCTC 1 cut(s) 79
BsnI GGCC 1 cut(s) 207
Bso31I GGTCTC 1 cut(s) 79
Bsp143I GATC 2 cut(s) 54, 217
BspANI GGCC 1 cut(s) 207
BspCNI CTCAG 2 cut(s) 61, 89
BspLI GGNNCC 1 cut(s) 208
BspPI GGATC 1 cut(s) 49
BspTNI GGTCTC 1 cut(s) 79
BsrDI GCAATG 1 cut(s) 152
BssECI CCNNGG 1 cut(s) 211
BssMI GATC 2 cut(s) 54, 217
BssSI CACGAG 1 cut(s) 81
BssT1I CCWWGG 1 cut(s) 211
Bst2BI CACGAG 1 cut(s) 81
BstC8I GCNNGC 1 cut(s) 108
BstDEI CTNAG 2 cut(s) 69, 76
BstF5I GGATG 1 cut(s) 8
BstKTI GATC 2 cut(s) 57, 220
BstMAI GTCTC 1 cut(s) 79
BstMBI GATC 2 cut(s) 54, 217
BstV2I GAAGAC 1 cut(s) 191
BsuRI GGCC 1 cut(s) 207
BtsCI GGATG 1 cut(s) 8
Cac8I GCNNGC 1 cut(s) 108
Cfr13I GGNCC 1 cut(s) 206
CviAII CATG 1 cut(s) 228
CviJI RGCY 7 cut(s) 36, 80, 88, 106, 152, 160, 207
CviKI_1 RGCY 7 cut(s) 36, 80, 88, 106, 152, 160, 207
DdeI CTNAG 2 cut(s) 69, 76
DpnI GATC 2 cut(s) 56, 219
DpnII GATC 2 cut(s) 54, 217
Eco130I CCWWGG 1 cut(s) 211
Eco31I GGTCTC 1 cut(s) 79
EcoO109I RGGNCCY 1 cut(s) 206
EcoT14I CCWWGG 1 cut(s) 211
ErhI CCWWGG 1 cut(s) 211
FaeI CATG 1 cut(s) 231
FaiI YATR 4 cut(s) 41, 117, 173, 229
FatI CATG 1 cut(s) 227
FspBI CTAG 2 cut(s) 89, 203
GsaI CCCAGC 1 cut(s) 160
HaeIII GGCC 1 cut(s) 207
Hin1II CATG 1 cut(s) 231
HphI GGTGA 1 cut(s) 227
Hpy188I TCNGA 1 cut(s) 70
Hpy188III TCNNGA 3 cut(s) 83, 137, 189
HpyCH4V TGCA 1 cut(s) 145
HpyF3I CTNAG 2 cut(s) 69, 76
Hsp92II CATG 1 cut(s) 231
Kzo9I GATC 2 cut(s) 54, 217
LpnPI CCDG 2 cut(s) 120, 170
LweI GCATC 2 cut(s) 14, 132
MaeI CTAG 2 cut(s) 89, 203
MalI GATC 2 cut(s) 56, 219
MboI GATC 2 cut(s) 54, 217
MboII GAAGA 3 cut(s) 17, 20, 191
MluCI AATT 1 cut(s) 96
MnlI CCTC 6 cut(s) 22, 64, 68, 76, 174, 178
MseI TTAA 1 cut(s) 232
NdeII GATC 2 cut(s) 54, 217
NlaIII CATG 1 cut(s) 231
NlaIV GGNNCC 1 cut(s) 208
PspFI CCCAGC 1 cut(s) 156
PspN4I GGNNCC 1 cut(s) 208
PspPI GGNCC 1 cut(s) 206
SaqAI TTAA 1 cut(s) 232
Sau3AI GATC 2 cut(s) 54, 217
Sau96I GGNCC 1 cut(s) 206
SetI ASST 5 cut(s) 75, 82, 90, 116, 162
SfaNI GCATC 2 cut(s) 14, 132
Sse9I AATT 1 cut(s) 96
SspMI CTAG 2 cut(s) 89, 203
StyI CCWWGG 1 cut(s) 211
TasI AATT 1 cut(s) 96
Tru1I TTAA 1 cut(s) 232
Tru9I TTAA 1 cut(s) 232
TspDTI ATGAA 1 cut(s) 216
XspI CTAG 2 cut(s) 89, 203
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.