RchiOBHm_Chr1g0339861

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0000866
Physical Location & Seq
Reverse (-)
31328845 .. 31329724
880 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ56670

Sequence Viewer

Length: 402 bp
ATGGCGTACTCAAAGACTATTCTTCTTGTTGTCTTTGCCGTTCTCCTCATCACTGCTGAGGTCTCAGCTCATCGTGACCTAACTGAGACAACCACTCCAACTATTGATGGTAATGGGGCATACAATAGAGGAGGCAATGGAGGAAACGGCGGAGGCAAGGGAGGAAACGGAGGATACGGAGGAGGAAGCAATGGAGGAAACGGAGGAGGCAAGGGAGGAAATGGAGGATACGGAGGAGGAAGTAATGGAGGAAACGGAGGTGGCAAAGGAGGAAACGGAGGAGGCAAGGGAGGAAACGGAGGAGGCAAGGGAGGCAATGGAGGAGGCAAGGGAGGAAAGGGAGGAAAGGGAGGAAAGGGAGGAAAGGGAGGGGGAGGGCATGGACCCGAAACCGAGAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

133

Amino Acids

11.78

Weight (kDa)

9.82

Isoelectric Point (pI)

10.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 150
AfaI GTAC 1 cut(s) 8
AluBI AGCT 1 cut(s) 68
AluI AGCT 1 cut(s) 68
Alw26I GTCTC 2 cut(s) 67, 80
AspS9I GGNCC 1 cut(s) 383
AvaII GGWCC 1 cut(s) 383
BbvCI CCTCAGC 1 cut(s) 57
BccI CCATC 1 cut(s) 101
BceAI ACGGC 2 cut(s) 23, 163
BciVI GTATCC 2 cut(s) 167, 221
BcoDI GTCTC 2 cut(s) 67, 80
BfaI CTAG 1 cut(s) 400
BfuI GTATCC 2 cut(s) 167, 221
Bme18I GGWCC 1 cut(s) 383
BmgT120I GGNCC 1 cut(s) 383
BmiI GGNNCC 1 cut(s) 385
Bpu10I CCTNAGC 1 cut(s) 57
BsaI GGTCTC 1 cut(s) 67
BsaXI ACNNNNNCTCC 2 cut(s) 79, 109
Bse3DI GCAATG 3 cut(s) 142, 196, 322
BseMI GCAATG 3 cut(s) 142, 196, 322
BseMII CTCAG 3 cut(s) 48, 75, 78
BseRI GAGGAG 8 cut(s) 35, 144, 195, 219, 249, 294, 315, 336
BsmAI GTCTC 2 cut(s) 67, 80
Bso31I GGTCTC 1 cut(s) 67
BspACI CCGC 1 cut(s) 150
BspCNI CTCAG 3 cut(s) 49, 76, 77
BspLI GGNNCC 1 cut(s) 385
BspTNI GGTCTC 1 cut(s) 67
BsrDI GCAATG 3 cut(s) 142, 196, 322
BstDEI CTNAG 3 cut(s) 57, 64, 84
BstMAI GTCTC 2 cut(s) 67, 80
BstMWI GCNNNNNNNGC 1 cut(s) 312
BsuI GTATCC 2 cut(s) 167, 221
BtsI GCAGTG 1 cut(s) 51
BtsIMutI CAGTG 1 cut(s) 51
Cfr13I GGNCC 1 cut(s) 383
Csp6I GTAC 1 cut(s) 7
CviAII CATG 1 cut(s) 380
CviJI RGCY 1 cut(s) 68
CviKI_1 RGCY 1 cut(s) 68
CviQI GTAC 1 cut(s) 7
DdeI CTNAG 3 cut(s) 57, 64, 84
EciI GGCGGA 1 cut(s) 165
Eco31I GGTCTC 1 cut(s) 67
Eco47I GGWCC 1 cut(s) 383
FaeI CATG 1 cut(s) 383
FaiI YATR 2 cut(s) 121, 381
FatI CATG 1 cut(s) 379
FspBI CTAG 1 cut(s) 400
Hin1II CATG 1 cut(s) 383
Hpy188III TCNNGA 1 cut(s) 74
HpyF10VI GCNNNNNNNGC 1 cut(s) 312
HpyF3I CTNAG 3 cut(s) 57, 64, 84
Hsp92II CATG 1 cut(s) 383
MaeI CTAG 1 cut(s) 400
MaeIII GTNAC 1 cut(s) 74
MboII GAAGA 1 cut(s) 14
MmeI TCCRAC 1 cut(s) 122
MwoI GCNNNNNNNGC 1 cut(s) 312
NlaIII CATG 1 cut(s) 383
NlaIV GGNNCC 1 cut(s) 385
NmuCI GTSAC 1 cut(s) 74
PspN4I GGNNCC 1 cut(s) 385
PspPI GGNCC 1 cut(s) 383
RsaI GTAC 1 cut(s) 8
RsaNI GTAC 1 cut(s) 7
Sau96I GGNCC 1 cut(s) 383
SetI ASST 4 cut(s) 63, 70, 81, 262
SgeI CNNG 9 cut(s) 38, 86, 169, 223, 298, 319, 340, 392, 398
SinI GGWCC 1 cut(s) 383
SsiI CCGC 1 cut(s) 150
SspMI CTAG 1 cut(s) 400
TscAI CASTG 1 cut(s) 58
TseFI GTSAC 1 cut(s) 74
Tsp45I GTSAC 1 cut(s) 74
TspGWI ACGGA 7 cut(s) 183, 192, 216, 246, 270, 291, 312
TspRI CASTG 1 cut(s) 58
VpaK11BI GGWCC 1 cut(s) 383
XspI CTAG 1 cut(s) 400
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.