RchiOBHm_Chr5g0041801

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0000866
Physical Location & Seq
Forward (+)
36677054 .. 36678282
1229 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ32023

Sequence Viewer

Length: 264 bp
ATGGCATTCTCAAAGACTATTCTTCTCGTTGCCCTTGTCTTTGCTGTTCTCCTCATCTCCTCTGAGGTCTCAGCTCATGAAAATTCTGACCACTTCCACGGCAACGATCATGGACATGGTGGCCATGGACATGGAGGACATGGACATGGAGGCGAAGGAGGACATGGACATGGAGGACATGGAGGACACGGAGGACATGGTGGCCATGGAGGCCGTGGAGGGCACGGAGGGCACGGACCTGGTGCTCATGAAACTGAGAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

87

Amino Acids

8.49

Weight (kDa)

6.38

Isoelectric Point (pI)

10.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 2 cut(s) 121, 202
AcsI RAATTY 1 cut(s) 82
AjnI CCWGG 1 cut(s) 238
AluBI AGCT 1 cut(s) 74
AluI AGCT 1 cut(s) 74
Alw21I GWGCWC 1 cut(s) 247
Alw26I GTCTC 1 cut(s) 73
AoxI GGCC 3 cut(s) 121, 202, 211
ApoI RAATTY 1 cut(s) 82
AspS9I GGNCC 1 cut(s) 236
AvaII GGWCC 1 cut(s) 236
BaeGI GKGCMC 2 cut(s) 225, 234
BalI TGGCCA 2 cut(s) 123, 204
Bbv12I GWGCWC 1 cut(s) 247
BceAI ACGGC 2 cut(s) 115, 198
BciT130I CCWGG 1 cut(s) 240
BcoDI GTCTC 1 cut(s) 73
BglI GCCNNNNNGGC 1 cut(s) 210
Bme1390I CCNGG 1 cut(s) 240
Bme18I GGWCC 1 cut(s) 236
BmgT120I GGNCC 1 cut(s) 236
BmrFI CCNGG 1 cut(s) 240
BsaI GGTCTC 1 cut(s) 73
BsaJI CCNNGG 4 cut(s) 97, 124, 205, 214
BseBI CCWGG 1 cut(s) 240
BseDI CCNNGG 4 cut(s) 97, 124, 205, 214
BseMII CTCAG 3 cut(s) 54, 84, 246
BseRI GAGGAG 2 cut(s) 41, 49
BseSI GKGCMC 2 cut(s) 225, 234
BshFI GGCC 3 cut(s) 123, 204, 213
BsiHKAI GWGCWC 1 cut(s) 247
BsmAI GTCTC 1 cut(s) 73
BsmI GAATGC 1 cut(s) 5
BsnI GGCC 3 cut(s) 123, 204, 213
Bso31I GGTCTC 1 cut(s) 73
Bsp1286I GDGCHC 3 cut(s) 225, 234, 247
Bsp143I GATC 1 cut(s) 106
Bsp19I CCATGG 2 cut(s) 124, 205
BspANI GGCC 3 cut(s) 123, 204, 213
BspCNI CTCAG 3 cut(s) 55, 83, 247
BspHI TCATGA 2 cut(s) 76, 247
BspTNI GGTCTC 1 cut(s) 73
BssECI CCNNGG 4 cut(s) 97, 124, 205, 214
BssMI GATC 1 cut(s) 106
BssT1I CCWWGG 2 cut(s) 124, 205
Bst2UI CCWGG 1 cut(s) 240
BstDEI CTNAG 3 cut(s) 63, 70, 255
BstDSI CCRYGG 4 cut(s) 97, 124, 205, 214
BstKTI GATC 1 cut(s) 109
BstMAI GTCTC 1 cut(s) 73
BstMBI GATC 1 cut(s) 106
BstMWI GCNNNNNNNGC 2 cut(s) 210, 229
BstNI CCWGG 1 cut(s) 240
BstSCI CCNGG 1 cut(s) 238
BstSLI GKGCMC 2 cut(s) 225, 234
BstXI CCANNNNNNTGG 1 cut(s) 131
BsuRI GGCC 3 cut(s) 123, 204, 213
BtgI CCRYGG 4 cut(s) 97, 124, 205, 214
CciI TCATGA 2 cut(s) 76, 247
Cfr13I GGNCC 1 cut(s) 236
CsiI ACCWGGT 1 cut(s) 238
CviJI RGCY 4 cut(s) 74, 123, 204, 213
CviKI_1 RGCY 4 cut(s) 74, 123, 204, 213
DdeI CTNAG 3 cut(s) 63, 70, 255
DpnI GATC 1 cut(s) 108
DpnII GATC 1 cut(s) 106
EaeI YGGCCR 2 cut(s) 121, 202
Eco130I CCWWGG 2 cut(s) 124, 205
Eco31I GGTCTC 1 cut(s) 73
Eco47I GGWCC 1 cut(s) 236
EcoRII CCWGG 1 cut(s) 238
EcoT14I CCWWGG 2 cut(s) 124, 205
ErhI CCWWGG 2 cut(s) 124, 205
HaeIII GGCC 3 cut(s) 123, 204, 213
Hpy188I TCNGA 2 cut(s) 64, 88
Hpy188III TCNNGA 2 cut(s) 77, 248
HpyAV CCTTC 1 cut(s) 149
HpyF10VI GCNNNNNNNGC 2 cut(s) 210, 229
HpyF3I CTNAG 3 cut(s) 63, 70, 255
Kzo9I GATC 1 cut(s) 106
LpnPI CCDG 2 cut(s) 225, 252
MabI ACCWGGT 1 cut(s) 238
MalI GATC 1 cut(s) 108
MboI GATC 1 cut(s) 106
MboII GAAGA 1 cut(s) 14
MhlI GDGCHC 3 cut(s) 225, 234, 247
MlsI TGGCCA 2 cut(s) 123, 204
MluCI AATT 2 cut(s) 82, 259
MluNI TGGCCA 2 cut(s) 123, 204
Mox20I TGGCCA 2 cut(s) 123, 204
MscI TGGCCA 2 cut(s) 123, 204
MslI CAYNNNNRTG 4 cut(s) 114, 129, 144, 168
Msp20I TGGCCA 2 cut(s) 123, 204
MspR9I CCNGG 1 cut(s) 240
Mva1269I GAATGC 1 cut(s) 5
MvaI CCWGG 1 cut(s) 240
MwoI GCNNNNNNNGC 2 cut(s) 210, 229
NcoI CCATGG 2 cut(s) 124, 205
NdeII GATC 1 cut(s) 106
PagI TCATGA 2 cut(s) 76, 247
PctI GAATGC 1 cut(s) 5
Psp6I CCWGG 1 cut(s) 238
PspGI CCWGG 1 cut(s) 238
PspPI GGNCC 1 cut(s) 236
RseI CAYNNNNRTG 4 cut(s) 114, 129, 144, 168
Sau3AI GATC 1 cut(s) 106
Sau96I GGNCC 1 cut(s) 236
ScrFI CCNGG 1 cut(s) 240
SduI GDGCHC 3 cut(s) 225, 234, 247
SetI ASST 3 cut(s) 69, 76, 241
SexAI ACCWGGT 1 cut(s) 238
SfiI GGCCNNNNNGGCC 1 cut(s) 210
SinI GGWCC 1 cut(s) 236
SmiMI CAYNNNNRTG 4 cut(s) 114, 129, 144, 168
Sse9I AATT 2 cut(s) 82, 259
StyD4I CCNGG 1 cut(s) 238
StyI CCWWGG 2 cut(s) 124, 205
TasI AATT 2 cut(s) 82, 259
TspDTI ATGAA 2 cut(s) 93, 264
TspGWI ACGGA 3 cut(s) 204, 240, 249
VpaK11BI GGWCC 1 cut(s) 236
XapI RAATTY 1 cut(s) 82
XcmI CCANNNNNNNNNTGG 1 cut(s) 212
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.