Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr3A

Orthogroup ID

OG0000866

Physical Location & Seq

Genomic Coordinates Reverse (-)

22591844 .. 22592923

Gene Structure 1080 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh3AG220700.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 477 bp

ATGCGCAAAAAGAAAAGGAAAAGAAAGAAATTAAACTGTGGGTCTCACAAATTGATCCCTCTTTCTCACTCGCTCACTCCTCTCCCACGTACTCGATCACTCTTCGAGGCCAAGAAGTCTATAAATAGGGAGGGCCAAGCTTCAGGAACTTCACTCAGAAATCAATCACCTCTTGCATACCTTCCTACAAACTCTAAGCAATCAAGAGAGATCGAGATGGCATTCTCAAAGACTTTTCTTCTTGTCGCCCTCGCCTTCGCTGTTCTCCTCATCTCTGCTGAGGTCTCGGCTCATCGTAACCTAGCTGAGACTACCACTACTACTCAAGAAGCCAACACTGACGGTCACCACGGACACGATCATGGACATGGCGGCCATGGAGGACATGGTGGACACGGAGGACATGGTGGACACGGAGGTCATGGAGGTCATGGAGGACATGGACCTCATGCTGTTGAGACTGAAACTGAGAACTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

158

Amino Acids

16.86

Weight (kDa)

10.0

Isoelectric Point (pI)

36.96

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
GRP	PF07172	73 - 147	1.2e-10	Glycine rich protein family

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000866)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g23680 FvH4_6g21640 FvH4_6g21640 FvH4_6g21650 FvH4_6g21660 FvH4_6g21660 FvH4_6g21670
malus_domestica	MD03G1191700.v1.1 MD03G1191900.v1.1 MD03G1192000.v1.1
prunus_persica	Prupe.4G225300_v2.0.a1 Prupe.4G225500_v2.0.a1 Prupe.4G225500_v2.0.a1 Prupe.4G225600_v2.0.a1 Prupe.4G225700_v2.0.a1 Prupe.4G225800_v2.0.a1 Prupe.4G226000_v2.0.a1 Prupe.4G226100_v2.0.a1 Prupe.4G226200_v2.0.a1 Prupe.4G227100_v2.0.a1
rosa_chinensis	RchiOBHm_Chr1g0339861 RchiOBHm_Chr1g0339881 RchiOBHm_Chr3g0478901 RchiOBHm_Chr5g0041801 RchiOBHm_Chr5g0041811
rosa_laevigata	RLG00000029243 RLG00000034095
rosa_multiflora	Rmu_co7998732.1_g000001 Rmu_co8433149.1_g000001 Rmu_sc0000861.1_g000038 Rmu_sc0003498.1_g000013 Rmu_sc0005255.1_g000010
rosa_roxburghii	Rroxscaffold_1G00038720 Rroxscaffold_1G00038730 Rroxscaffold_4G00313770 Rroxscaffold_4G00313780 Rroxscaffold_4G00315370 Rroxscaffold_4G00315380 Rroxscaffold_6G00402890
rosa_rugosa	Rorug01G0124600 Rorug01G0124700 Rorug01G0138700.1 Rorug01G0139000.1 Rorug01G0139200.1 Rorug01G0139300.1 Rorug03G0169100 Rorug03G0169200 Rorug03G0169200 Rorug05G0195300 Rorug05G0195400
rosa_samantha	Rh1AG157200 Rh1CG146900 Rh3AG220700 Rh3BG252600 Rh3CG249400 Rh5AG280600 Rh5AG280700 Rh5BG286600 Rh5DG295300
rosa_wichuraiana	Rw1G012890 Rw1G012900 Rw1G012910 Rw1G012920 Rw1G012950 Rw1G012970 Rw3G019850 Rw5G026470

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	417
Acc16I	TGCGCA	1 cut(s)	5
AciI	CCGC	1 cut(s)	372
AclWI	GGATC	1 cut(s)	49
AcoI	YGGCCR	1 cut(s)	373
AcuI	CTGAAG	1 cut(s)	126
AfaI	GTAC	1 cut(s)	91
AluBI	AGCT	2 cut(s)	140, 305
AluI	AGCT	2 cut(s)	140, 305
Alw26I	GTCTC	4 cut(s)	48, 289, 302, 452
AlwI	GGATC	1 cut(s)	49
AoxI	GGCC	3 cut(s)	108, 133, 373
AspLEI	GCGC	1 cut(s)	6
AspS9I	GGNCC	2 cut(s)	133, 443
AsuHPI	GGTGA	2 cut(s)	159, 338
AvaII	GGWCC	1 cut(s)	443
BbvCI	CCTCAGC	1 cut(s)	279
BccI	CCATC	1 cut(s)	211
BcoDI	GTCTC	4 cut(s)	48, 289, 302, 452
BfaI	CTAG	2 cut(s)	302, 475
BisI	GCNGC	1 cut(s)	373
BlsI	GCNGC	1 cut(s)	374
Bme18I	GGWCC	1 cut(s)	443
BmgT120I	GGNCC	2 cut(s)	133, 443
Bpu10I	CCTNAGC	1 cut(s)	279
BpuEI	CTTGAG	1 cut(s)	309
BsaAI	YACGTR	1 cut(s)	89
BsaI	GGTCTC	2 cut(s)	48, 289
BsaJI	CCNNGG	2 cut(s)	349, 376
BseDI	CCNNGG	2 cut(s)	349, 376
BseMII	CTCAG	4 cut(s)	169, 270, 297, 459
BseRI	GAGGAG	2 cut(s)	69, 257
BshFI	GGCC	3 cut(s)	110, 135, 375
BsmAI	GTCTC	4 cut(s)	48, 289, 302, 452
BsmI	GAATGC	1 cut(s)	221
BsnI	GGCC	3 cut(s)	110, 135, 375
Bso31I	GGTCTC	2 cut(s)	48, 289
Bsp143I	GATC	4 cut(s)	54, 95, 210, 358
Bsp19I	CCATGG	1 cut(s)	376
BspACI	CCGC	1 cut(s)	372
BspANI	GGCC	3 cut(s)	110, 135, 375
BspCNI	CTCAG	4 cut(s)	168, 271, 298, 460
BspPI	GGATC	1 cut(s)	49
BspTNI	GGTCTC	2 cut(s)	48, 289
BssECI	CCNNGG	2 cut(s)	349, 376
BssMI	GATC	4 cut(s)	54, 95, 210, 358
BssT1I	CCWWGG	1 cut(s)	376
Bst4CI	ACNGT	2 cut(s)	38, 344
Bst6I	CTCTTC	1 cut(s)	107
BstBAI	YACGTR	1 cut(s)	89
BstDEI	CTNAG	5 cut(s)	155, 195, 279, 306, 468
BstDSI	CCRYGG	2 cut(s)	349, 376
BstEII	GGTNACC	1 cut(s)	344
BstHHI	GCGC	1 cut(s)	6
BstKTI	GATC	4 cut(s)	57, 98, 213, 361
BstMAI	GTCTC	4 cut(s)	48, 289, 302, 452
BstMBI	GATC	4 cut(s)	54, 95, 210, 358
BstPI	GGTNACC	1 cut(s)	344
BsuRI	GGCC	3 cut(s)	110, 135, 375
BtgI	CCRYGG	2 cut(s)	349, 376
BtsIMutI	CAGTG	1 cut(s)	336
CfoI	GCGC	1 cut(s)	6
Cfr13I	GGNCC	2 cut(s)	133, 443
Csp6I	GTAC	1 cut(s)	90
CviAII	CATG	9 cut(s)	362, 368, 377, 386, 404, 422, 431, 440, 449
CviJI	RGCY	7 cut(s)	110, 135, 140, 290, 305, 332, 375
CviKI_1	RGCY	7 cut(s)	110, 135, 140, 290, 305, 332, 375
CviQI	GTAC	1 cut(s)	90
DdeI	CTNAG	5 cut(s)	155, 195, 279, 306, 468
DpnI	GATC	4 cut(s)	56, 97, 212, 360
DpnII	GATC	4 cut(s)	54, 95, 210, 358
DrdI	GACNNNNNNGTC	1 cut(s)	417
DseDI	GACNNNNNNGTC	1 cut(s)	417
EaeI	YGGCCR	1 cut(s)	373
Eam1104I	CTCTTC	1 cut(s)	107
EarI	CTCTTC	1 cut(s)	107
Eco130I	CCWWGG	1 cut(s)	376
Eco31I	GGTCTC	2 cut(s)	48, 289
Eco47I	GGWCC	1 cut(s)	443
Eco57I	CTGAAG	1 cut(s)	126
Eco91I	GGTNACC	1 cut(s)	344
EcoO65I	GGTNACC	1 cut(s)	344
EcoT14I	CCWWGG	1 cut(s)	376
ErhI	CCWWGG	1 cut(s)	376
FaeI	CATG	9 cut(s)	365, 371, 380, 389, 407, 425, 434, 443, 452
FatI	CATG	9 cut(s)	361, 367, 376, 385, 403, 421, 430, 439, 448
Fnu4HI	GCNGC	1 cut(s)	373
Fsp4HI	GCNGC	1 cut(s)	373
FspBI	CTAG	2 cut(s)	302, 475
FspI	TGCGCA	1 cut(s)	5
GlaI	GCGC	1 cut(s)	5
GluI	GCNGC	1 cut(s)	373
HaeIII	GGCC	3 cut(s)	110, 135, 375
HhaI	GCGC	1 cut(s)	6
Hin1II	CATG	9 cut(s)	365, 371, 380, 389, 407, 425, 434, 443, 452
Hin6I	GCGC	1 cut(s)	4
HinP1I	GCGC	1 cut(s)	4
HindIII	AAGCTT	1 cut(s)	138
HphI	GGTGA	2 cut(s)	159, 338
Hpy166II	GTNNAC	2 cut(s)	392, 410
Hpy188I	TCNGA	1 cut(s)	158
Hpy188III	TCNNGA	4 cut(s)	144, 204, 214, 326
Hpy8I	GTNNAC	2 cut(s)	392, 410
HpyAV	CCTTC	2 cut(s)	191, 265
HpyCH4III	ACNGT	2 cut(s)	38, 344
HpyCH4IV	ACGT	1 cut(s)	88
HpyCH4V	TGCA	1 cut(s)	176
HpyF3I	CTNAG	5 cut(s)	155, 195, 279, 306, 468
HpySE526I	ACGT	1 cut(s)	88
Hsp92II	CATG	9 cut(s)	365, 371, 380, 389, 407, 425, 434, 443, 452
HspAI	GCGC	1 cut(s)	4
Kzo9I	GATC	4 cut(s)	54, 95, 210, 358
LpnPI	CCDG	1 cut(s)	129
MaeI	CTAG	2 cut(s)	302, 475
MaeII	ACGT	1 cut(s)	88
MaeIII	GTNAC	2 cut(s)	296, 344
MalI	GATC	4 cut(s)	56, 97, 212, 360
MboI	GATC	4 cut(s)	54, 95, 210, 358
MboII	GAAGA	2 cut(s)	94, 230
MluCI	AATT	2 cut(s)	29, 50
MseI	TTAA	1 cut(s)	32
MslI	CAYNNNNRTG	2 cut(s)	360, 366
Mva1269I	GAATGC	1 cut(s)	221
NcoI	CCATGG	1 cut(s)	376
NdeII	GATC	4 cut(s)	54, 95, 210, 358
NlaIII	CATG	9 cut(s)	365, 371, 380, 389, 407, 425, 434, 443, 452
NmeAIII	GCCGAG	1 cut(s)	266
NmuCI	GTSAC	1 cut(s)	344
NsbI	TGCGCA	1 cut(s)	5
PctI	GAATGC	1 cut(s)	221
PkrI	GCNGC	1 cut(s)	374
Ppu21I	YACGTR	1 cut(s)	89
PspEI	GGTNACC	1 cut(s)	344
PspPI	GGNCC	2 cut(s)	133, 443
RsaI	GTAC	1 cut(s)	91
RsaNI	GTAC	1 cut(s)	90
RseI	CAYNNNNRTG	2 cut(s)	360, 366
SaqAI	TTAA	1 cut(s)	32
SatI	GCNGC	1 cut(s)	373
Sau3AI	GATC	4 cut(s)	54, 95, 210, 358
Sau96I	GGNCC	2 cut(s)	133, 443
SinI	GGWCC	1 cut(s)	443
SmiMI	CAYNNNNRTG	2 cut(s)	360, 366
SmlI	CTYRAG	1 cut(s)	324
SmoI	CTYRAG	1 cut(s)	324
Sse9I	AATT	2 cut(s)	29, 50
SsiI	CCGC	1 cut(s)	372
SspMI	CTAG	2 cut(s)	302, 475
StyI	CCWWGG	1 cut(s)	376
TaaI	ACNGT	2 cut(s)	38, 344
TaiI	ACGT	1 cut(s)	91
TaqI	TCGA	3 cut(s)	94, 105, 213
TasI	AATT	2 cut(s)	29, 50
TauI	GCSGC	1 cut(s)	375
Tru1I	TTAA	1 cut(s)	32
Tru9I	TTAA	1 cut(s)	32
TscAI	CASTG	1 cut(s)	343
TseFI	GTSAC	1 cut(s)	344
Tsp45I	GTSAC	1 cut(s)	344
TspGWI	ACGGA	3 cut(s)	366, 411, 429
TspRI	CASTG	1 cut(s)	343
VpaK11BI	GGWCC	1 cut(s)	443
XcmI	CCANNNNNNNNNTGG	1 cut(s)	383
XspI	CTAG	2 cut(s)	302, 475

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.