MD03G1192000.v1.1

Cold and drought-regulated protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr03
Physical Location & Seq
Reverse (-)
26336624 .. 26337360
737 bp
Loading structure...
UTR
Exon/CDS
Intron
MD03G1192000.v1.1.491

Sequence Viewer

Length: 222 bp
ATGGCATCCTCAGGGACTTTACTTCTTCTTGGCCTTGTCTTTGCTGTTCTCCTTCTCTCCTCTGAAATCTCAGCTCGTGAGCTAGCTGAGACTACTCCTCAAACCCAGGACAGCGTAGAAAAGGCTGGCAACCAAGTTCAGGGCCATGAGCATGGACATGACCACGGTCATGGAGGGCATGGACATGACCATGGTCACGGAGGTCATGGCCACAGGCCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

7.61

Weight (kDa)

6.07

Isoelectric Point (pI)

19.64

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GRP PF07172 1 - 70 7.3e-10 Glycine rich protein family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 208
AfiI CCNNNNNNNGG 1 cut(s) 139
AjnI CCWGG 1 cut(s) 105
AluBI AGCT 3 cut(s) 74, 82, 86
AluI AGCT 3 cut(s) 74, 82, 86
Alw26I GTCTC 1 cut(s) 83
AoxI GGCC 4 cut(s) 31, 142, 208, 215
AspS9I GGNCC 1 cut(s) 142
AsuNHI GCTAGC 1 cut(s) 82
AxyI CCTNAGG 1 cut(s) 10
BalI TGGCCA 1 cut(s) 210
BauI CACGAG 1 cut(s) 75
BciT130I CCWGG 1 cut(s) 107
BcoDI GTCTC 1 cut(s) 83
BfaI CTAG 1 cut(s) 83
Bme1390I CCNGG 1 cut(s) 107
BmgT120I GGNCC 1 cut(s) 142
BmrFI CCNGG 1 cut(s) 107
BmsI GCATC 1 cut(s) 14
BmtI GCTAGC 1 cut(s) 86
BoxI GACNNNNGTC 2 cut(s) 165, 192
BsaJI CCNNGG 3 cut(s) 105, 163, 190
Bsc4I CCNNNNNNNGG 1 cut(s) 139
Bse21I CCTNAGG 1 cut(s) 10
BseBI CCWGG 1 cut(s) 107
BseDI CCNNGG 3 cut(s) 105, 163, 190
BseGI GGATG 1 cut(s) 5
BseLI CCNNNNNNNGG 1 cut(s) 139
BseMII CTCAG 3 cut(s) 24, 78, 84
BseRI GAGGAG 2 cut(s) 49, 87
BshFI GGCC 4 cut(s) 33, 144, 210, 217
BslFI GGGAC 1 cut(s) 28
BslI CCNNNNNNNGG 1 cut(s) 139
BsmAI GTCTC 1 cut(s) 83
BsmFI GGGAC 1 cut(s) 28
BsnI GGCC 4 cut(s) 33, 144, 210, 217
Bsp19I CCATGG 1 cut(s) 190
BspANI GGCC 4 cut(s) 33, 144, 210, 217
BspCNI CTCAG 3 cut(s) 23, 79, 83
BspOI GCTAGC 1 cut(s) 86
BssECI CCNNGG 3 cut(s) 105, 163, 190
BssSI CACGAG 1 cut(s) 75
BssT1I CCWWGG 1 cut(s) 190
Bst2BI CACGAG 1 cut(s) 75
Bst2UI CCWGG 1 cut(s) 107
Bst4CI ACNGT 1 cut(s) 167
BstC8I GCNNGC 2 cut(s) 84, 127
BstDEI CTNAG 3 cut(s) 10, 70, 87
BstDSI CCRYGG 2 cut(s) 163, 190
BstF5I GGATG 1 cut(s) 5
BstMAI GTCTC 1 cut(s) 83
BstNI CCWGG 1 cut(s) 107
BstPAI GACNNNNGTC 2 cut(s) 165, 192
BstSCI CCNGG 1 cut(s) 105
BstXI CCANNNNNNTGG 2 cut(s) 152, 170
Bsu36I CCTNAGG 1 cut(s) 10
BsuRI GGCC 4 cut(s) 33, 144, 210, 217
BtgI CCRYGG 2 cut(s) 163, 190
BtsCI GGATG 1 cut(s) 5
Cac8I GCNNGC 2 cut(s) 84, 127
Cfr13I GGNCC 1 cut(s) 142
CviAII CATG 9 cut(s) 146, 152, 158, 170, 179, 185, 191, 206, 219
CviJI RGCY 8 cut(s) 33, 74, 82, 86, 125, 144, 210, 217
CviKI_1 RGCY 8 cut(s) 33, 74, 82, 86, 125, 144, 210, 217
DdeI CTNAG 3 cut(s) 10, 70, 87
EaeI YGGCCR 1 cut(s) 208
Eco130I CCWWGG 1 cut(s) 190
Eco81I CCTNAGG 1 cut(s) 10
EcoRII CCWGG 1 cut(s) 105
EcoT14I CCWWGG 1 cut(s) 190
ErhI CCWWGG 1 cut(s) 190
FaeI CATG 9 cut(s) 149, 155, 161, 173, 182, 188, 194, 209, 222
FaiI YATR 9 cut(s) 147, 153, 159, 171, 180, 186, 192, 207, 220
FaqI GGGAC 1 cut(s) 28
FatI CATG 9 cut(s) 145, 151, 157, 169, 178, 184, 190, 205, 218
FspBI CTAG 1 cut(s) 83
HaeIII GGCC 4 cut(s) 33, 144, 210, 217
Hin1II CATG 9 cut(s) 149, 155, 161, 173, 182, 188, 194, 209, 222
Hpy188I TCNGA 1 cut(s) 64
Hpy188III TCNNGA 1 cut(s) 77
HpyAV CCTTC 1 cut(s) 62
HpyCH4III ACNGT 1 cut(s) 167
HpyF3I CTNAG 3 cut(s) 10, 70, 87
Hsp92II CATG 9 cut(s) 149, 155, 161, 173, 182, 188, 194, 209, 222
LpnPI CCDG 5 cut(s) 92, 111, 119, 125, 199
LweI GCATC 1 cut(s) 14
MaeI CTAG 1 cut(s) 83
MaeIII GTNAC 1 cut(s) 194
MboII GAAGA 1 cut(s) 17
MlsI TGGCCA 1 cut(s) 210
MluNI TGGCCA 1 cut(s) 210
MnlI CCTC 5 cut(s) 19, 70, 108, 167, 194
Mox20I TGGCCA 1 cut(s) 210
MscI TGGCCA 1 cut(s) 210
MslI CAYNNNNRTG 5 cut(s) 150, 156, 168, 183, 189
Msp20I TGGCCA 1 cut(s) 210
MspR9I CCNGG 1 cut(s) 107
MvaI CCWGG 1 cut(s) 107
NcoI CCATGG 1 cut(s) 190
NheI GCTAGC 1 cut(s) 82
NlaIII CATG 9 cut(s) 149, 155, 161, 173, 182, 188, 194, 209, 222
NmuCI GTSAC 1 cut(s) 194
PshAI GACNNNNGTC 2 cut(s) 165, 192
Psp6I CCWGG 1 cut(s) 105
PspGI CCWGG 1 cut(s) 105
PspPI GGNCC 1 cut(s) 142
RseI CAYNNNNRTG 5 cut(s) 150, 156, 168, 183, 189
Sau96I GGNCC 1 cut(s) 142
ScrFI CCNGG 1 cut(s) 107
SetI ASST 4 cut(s) 76, 84, 88, 205
SfaNI GCATC 1 cut(s) 14
SmiMI CAYNNNNRTG 5 cut(s) 150, 156, 168, 183, 189
SspMI CTAG 1 cut(s) 83
StyD4I CCNGG 1 cut(s) 105
StyI CCWWGG 1 cut(s) 190
TaaI ACNGT 1 cut(s) 167
TseFI GTSAC 1 cut(s) 194
Tsp45I GTSAC 1 cut(s) 194
TspGWI ACGGA 1 cut(s) 213
XspI CTAG 1 cut(s) 83
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.