Rw1G012910

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr1
OG0000866
Physical Location & Seq
Forward (+)
28776089 .. 28776451
363 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw1G012910.1

Sequence Viewer

Length: 255 bp
ATGGCATTCTCAAAGACTTTTCTTCTTGTCGCCCTTGCCTTTGCTGTTCTCCTCATCTCTGCTGAGGTCTCGGCTCATCGTGACTTAGCTGAGGCTACCACTACTACTCAAAAAGCCAACACTGAAGGTTACGACGGACACGATCATGGACATGGCGGCTATGGACACGGAGGATATGGACATGGAGGACATGGTGGACACGGAGGACATGGAGGACATGGACCTCATGCTGTTGAGACTGAAACTGAGAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

84

Amino Acids

8.57

Weight (kDa)

5.93

Isoelectric Point (pI)

13.48

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GRP PF07172 1 - 72 1e-10 Glycine rich protein family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 156
AcuI CTGAAG 1 cut(s) 144
AluBI AGCT 1 cut(s) 89
AluI AGCT 1 cut(s) 89
Alw26I GTCTC 2 cut(s) 73, 230
AspS9I GGNCC 1 cut(s) 221
AvaII GGWCC 1 cut(s) 221
BbvCI CCTCAGC 2 cut(s) 63, 90
BcoDI GTCTC 2 cut(s) 73, 230
BfaI CTAG 1 cut(s) 253
BisI GCNGC 1 cut(s) 157
BlsI GCNGC 1 cut(s) 158
Bme18I GGWCC 1 cut(s) 221
BmgT120I GGNCC 1 cut(s) 221
Bpu10I CCTNAGC 2 cut(s) 63, 90
BsaI GGTCTC 1 cut(s) 73
BseMII CTCAG 3 cut(s) 54, 81, 237
BseRI GAGGAG 1 cut(s) 41
BsmAI GTCTC 2 cut(s) 73, 230
BsmI GAATGC 1 cut(s) 5
Bso31I GGTCTC 1 cut(s) 73
Bsp143I GATC 1 cut(s) 142
BspACI CCGC 1 cut(s) 156
BspCNI CTCAG 3 cut(s) 55, 82, 238
BspTNI GGTCTC 1 cut(s) 73
BssMI GATC 1 cut(s) 142
BstDEI CTNAG 4 cut(s) 63, 85, 90, 246
BstKTI GATC 1 cut(s) 145
BstMAI GTCTC 2 cut(s) 73, 230
BstMBI GATC 1 cut(s) 142
BtsIMutI CAGTG 1 cut(s) 120
Cfr13I GGNCC 1 cut(s) 221
CviAII CATG 7 cut(s) 146, 152, 182, 191, 209, 218, 227
CviJI RGCY 5 cut(s) 74, 89, 95, 116, 159
CviKI_1 RGCY 5 cut(s) 74, 89, 95, 116, 159
DdeI CTNAG 4 cut(s) 63, 85, 90, 246
DpnI GATC 1 cut(s) 144
DpnII GATC 1 cut(s) 142
Eco31I GGTCTC 1 cut(s) 73
Eco47I GGWCC 1 cut(s) 221
Eco57I CTGAAG 1 cut(s) 144
FaeI CATG 7 cut(s) 149, 155, 185, 194, 212, 221, 230
FaiI YATR 9 cut(s) 147, 153, 162, 177, 183, 192, 210, 219, 228
FatI CATG 7 cut(s) 145, 151, 181, 190, 208, 217, 226
Fnu4HI GCNGC 1 cut(s) 157
Fsp4HI GCNGC 1 cut(s) 157
FspBI CTAG 1 cut(s) 253
GluI GCNGC 1 cut(s) 157
Hin1II CATG 7 cut(s) 149, 155, 185, 194, 212, 221, 230
Hpy166II GTNNAC 1 cut(s) 197
Hpy188III TCNNGA 1 cut(s) 80
Hpy8I GTNNAC 1 cut(s) 197
Hpy99I CGWCG 1 cut(s) 137
HpyAV CCTTC 1 cut(s) 119
HpyF3I CTNAG 4 cut(s) 63, 85, 90, 246
Hsp92II CATG 7 cut(s) 149, 155, 185, 194, 212, 221, 230
Kzo9I GATC 1 cut(s) 142
MaeI CTAG 1 cut(s) 253
MaeIII GTNAC 2 cut(s) 80, 128
MalI GATC 1 cut(s) 144
MboI GATC 1 cut(s) 142
MboII GAAGA 1 cut(s) 14
MnlI CCTC 8 cut(s) 58, 62, 85, 164, 179, 197, 206, 234
MslI CAYNNNNRTG 2 cut(s) 144, 150
Mva1269I GAATGC 1 cut(s) 5
NdeII GATC 1 cut(s) 142
NlaIII CATG 7 cut(s) 149, 155, 185, 194, 212, 221, 230
NmeAIII GCCGAG 1 cut(s) 50
NmuCI GTSAC 1 cut(s) 80
PcsI WCGNNNNNNNCGW 1 cut(s) 138
PctI GAATGC 1 cut(s) 5
PkrI GCNGC 1 cut(s) 158
PspPI GGNCC 1 cut(s) 221
RseI CAYNNNNRTG 2 cut(s) 144, 150
SatI GCNGC 1 cut(s) 157
Sau3AI GATC 1 cut(s) 142
Sau96I GGNCC 1 cut(s) 221
SetI ASST 4 cut(s) 69, 91, 130, 226
SinI GGWCC 1 cut(s) 221
SmiMI CAYNNNNRTG 2 cut(s) 144, 150
SsiI CCGC 1 cut(s) 156
SspMI CTAG 1 cut(s) 253
TauI GCSGC 1 cut(s) 159
TscAI CASTG 1 cut(s) 127
TseFI GTSAC 1 cut(s) 80
Tsp45I GTSAC 1 cut(s) 80
TspGWI ACGGA 3 cut(s) 150, 183, 216
TspRI CASTG 1 cut(s) 127
VpaK11BI GGWCC 1 cut(s) 221
XspI CTAG 1 cut(s) 253
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.