Prupe.4G227100_v2.0.a1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
OG0000866
Physical Location & Seq
Forward (+)
14458603 .. 14459460
858 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G227100.1

Sequence Viewer

Length: 291 bp
ATGGCATCCTCGAAGACTTTTCTTCTTCTTGGCCTTGTGTGTGTTGTTCTCATTCTCATCGTCTCCGAGGCCTCAGCTCGTGAGCTAGCTGAAACTACTACTCAAATTAATCAACGGAAACTGATCAATGGTGCCTACGAGAGAAGTGGACATGGAGGGCGCGTTGCCTATGGACGTGGTGTCTACAACCGTGGAGGGCAAGGTACCTATGGACGTGGTGTCTACAACCGTGGAGGAAAAGGTGGTCACAGACGTGAGCGAGACCCCTACAGTCGAGGAGGGAAAGGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

97

Amino Acids

10.33

Weight (kDa)

10.51

Isoelectric Point (pI)

16.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 203
AccB1I GGYRCC 2 cut(s) 131, 203
AccI GTMKAC 2 cut(s) 183, 222
AccII CGCG 1 cut(s) 162
AfaI GTAC 1 cut(s) 205
AhdI GACNNNNNGTC 2 cut(s) 179, 218
AjiI CACGTC 3 cut(s) 176, 215, 254
AleI CACNNNNGTG 1 cut(s) 252
AluBI AGCT 3 cut(s) 77, 85, 89
AluI AGCT 3 cut(s) 77, 85, 89
Alw26I GTCTC 2 cut(s) 67, 255
AoxI GGCC 2 cut(s) 31, 69
AseI ATTAAT 1 cut(s) 108
Asp718I GGTACC 1 cut(s) 203
AspLEI GCGC 1 cut(s) 162
AsuNHI GCTAGC 1 cut(s) 85
BanI GGYRCC 2 cut(s) 131, 203
BauI CACGAG 1 cut(s) 78
BbsI GAAGAC 1 cut(s) 20
BbvCI CCTCAGC 1 cut(s) 73
BclI TGATCA 1 cut(s) 123
BcoDI GTCTC 2 cut(s) 67, 255
BfaI CTAG 1 cut(s) 86
BfmI CTRYAG 1 cut(s) 268
BmeRI GACNNNNNGTC 2 cut(s) 179, 218
BmgBI CACGTC 3 cut(s) 176, 215, 254
BmiI GGNNCC 2 cut(s) 133, 205
BmsI GCATC 1 cut(s) 14
BmtI GCTAGC 1 cut(s) 89
BpiI GAAGAC 1 cut(s) 20
Bpu10I CCTNAGC 1 cut(s) 73
BsaI GGTCTC 1 cut(s) 255
BsaJI CCNNGG 3 cut(s) 66, 190, 229
BsaXI ACNNNNNCTCC 2 cut(s) 147, 177
BseDI CCNNGG 3 cut(s) 66, 190, 229
BseGI GGATG 1 cut(s) 5
BseMII CTCAG 1 cut(s) 87
BseRI GAGGAG 1 cut(s) 291
Bsh1236I CGCG 1 cut(s) 162
BshFI GGCC 2 cut(s) 33, 71
BshNI GGYRCC 2 cut(s) 131, 203
BsmAI GTCTC 2 cut(s) 67, 255
BsmBI CGTCTC 1 cut(s) 67
BsnI GGCC 2 cut(s) 33, 71
Bso31I GGTCTC 1 cut(s) 255
Bsp143I GATC 1 cut(s) 123
BspANI GGCC 2 cut(s) 33, 71
BspCNI CTCAG 1 cut(s) 86
BspFNI CGCG 1 cut(s) 162
BspLI GGNNCC 2 cut(s) 133, 205
BspOI GCTAGC 1 cut(s) 89
BspT107I GGYRCC 2 cut(s) 131, 203
BspTNI GGTCTC 1 cut(s) 255
BssECI CCNNGG 3 cut(s) 66, 190, 229
BssMI GATC 1 cut(s) 123
BssSI CACGAG 1 cut(s) 78
Bst2BI CACGAG 1 cut(s) 78
Bst4CI ACNGT 3 cut(s) 191, 230, 272
BstC8I GCNNGC 1 cut(s) 87
BstDEI CTNAG 1 cut(s) 73
BstDSI CCRYGG 2 cut(s) 190, 229
BstF5I GGATG 1 cut(s) 5
BstFNI CGCG 1 cut(s) 162
BstHHI GCGC 1 cut(s) 162
BstKTI GATC 1 cut(s) 126
BstMAI GTCTC 2 cut(s) 67, 255
BstMBI GATC 1 cut(s) 123
BstSFI CTRYAG 1 cut(s) 268
BstUI CGCG 1 cut(s) 162
BstV2I GAAGAC 1 cut(s) 20
BsuRI GGCC 2 cut(s) 33, 71
BtgI CCRYGG 2 cut(s) 190, 229
BtrI CACGTC 3 cut(s) 176, 215, 254
BtsCI GGATG 1 cut(s) 5
Cac8I GCNNGC 1 cut(s) 87
CfoI GCGC 1 cut(s) 162
Csp6I GTAC 1 cut(s) 204
CviAII CATG 1 cut(s) 152
CviJI RGCY 5 cut(s) 33, 71, 77, 85, 89
CviKI_1 RGCY 5 cut(s) 33, 71, 77, 85, 89
CviQI GTAC 1 cut(s) 204
DdeI CTNAG 1 cut(s) 73
DpnI GATC 1 cut(s) 125
DpnII GATC 1 cut(s) 123
DriI GACNNNNNGTC 2 cut(s) 179, 218
Eam1105I GACNNNNNGTC 2 cut(s) 179, 218
Eco147I AGGCCT 1 cut(s) 71
Eco31I GGTCTC 1 cut(s) 255
Esp3I CGTCTC 1 cut(s) 67
FaeI CATG 1 cut(s) 155
FaiI YATR 3 cut(s) 153, 171, 210
FatI CATG 1 cut(s) 151
FbaI TGATCA 1 cut(s) 123
FblI GTMKAC 2 cut(s) 183, 222
FspBI CTAG 1 cut(s) 86
GlaI GCGC 1 cut(s) 161
HaeIII GGCC 2 cut(s) 33, 71
HhaI GCGC 1 cut(s) 162
Hin1II CATG 1 cut(s) 155
Hin6I GCGC 1 cut(s) 160
HinP1I GCGC 1 cut(s) 160
Hpy166II GTNNAC 3 cut(s) 149, 184, 223
Hpy188I TCNGA 1 cut(s) 67
Hpy188III TCNNGA 1 cut(s) 80
Hpy8I GTNNAC 3 cut(s) 149, 184, 223
HpyCH4III ACNGT 3 cut(s) 191, 230, 272
HpyCH4IV ACGT 3 cut(s) 175, 214, 253
HpyF3I CTNAG 1 cut(s) 73
HpySE526I ACGT 3 cut(s) 175, 214, 253
Hsp92II CATG 1 cut(s) 155
HspAI GCGC 1 cut(s) 160
KpnI GGTACC 1 cut(s) 207
Ksp22I TGATCA 1 cut(s) 123
Kzo9I GATC 1 cut(s) 123
LweI GCATC 1 cut(s) 14
MaeI CTAG 1 cut(s) 86
MaeII ACGT 3 cut(s) 175, 214, 253
MaeIII GTNAC 1 cut(s) 245
MalI GATC 1 cut(s) 125
MboI GATC 1 cut(s) 123
MboII GAAGA 3 cut(s) 14, 17, 25
MluCI AATT 1 cut(s) 105
MnlI CCTC 8 cut(s) 19, 61, 82, 149, 188, 227, 269, 272
MseI TTAA 1 cut(s) 108
MslI CAYNNNNRTG 1 cut(s) 252
MvnI CGCG 1 cut(s) 162
NdeII GATC 1 cut(s) 123
NheI GCTAGC 1 cut(s) 85
NlaIII CATG 1 cut(s) 155
NlaIV GGNNCC 2 cut(s) 133, 205
NmuCI GTSAC 1 cut(s) 245
OliI CACNNNNGTG 1 cut(s) 252
PceI AGGCCT 1 cut(s) 71
PshBI ATTAAT 1 cut(s) 108
PspN4I GGNNCC 2 cut(s) 133, 205
RsaI GTAC 1 cut(s) 205
RsaNI GTAC 1 cut(s) 204
RseI CAYNNNNRTG 1 cut(s) 252
SaqAI TTAA 1 cut(s) 108
Sau3AI GATC 1 cut(s) 123
SetI ASST 9 cut(s) 79, 87, 91, 178, 205, 209, 217, 244, 256
SfaNI GCATC 1 cut(s) 14
SfcI CTRYAG 1 cut(s) 268
SmiMI CAYNNNNRTG 1 cut(s) 252
Sse9I AATT 1 cut(s) 105
SseBI AGGCCT 1 cut(s) 71
SspMI CTAG 1 cut(s) 86
StuI AGGCCT 1 cut(s) 71
TaaI ACNGT 3 cut(s) 191, 230, 272
TaiI ACGT 3 cut(s) 178, 217, 256
TaqI TCGA 2 cut(s) 11, 274
TasI AATT 1 cut(s) 105
Tru1I TTAA 1 cut(s) 108
Tru9I TTAA 1 cut(s) 108
TseFI GTSAC 1 cut(s) 245
Tsp45I GTSAC 1 cut(s) 245
TspGWI ACGGA 1 cut(s) 130
VspI ATTAAT 1 cut(s) 108
XmiI GTMKAC 2 cut(s) 183, 222
XspI CTAG 1 cut(s) 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.