Rw1G012900

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr1
OG0000866
Physical Location & Seq
Forward (+)
28722752 .. 28723206
455 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw1G012900.1

Sequence Viewer

Length: 345 bp
ATGGCATTCTCAAAGACTTTTCTTCTTGTCGCCCTTGCCTTTGCTGTTCTCCTCATCTCTGCTAAGGTCTCGGCTCATCGTGACCTAGCTGAGGCTGCCACTACTACTCAAAAAGACAACACTGACGGTTACCATGGACACGATCATGGACATGGCGGCCATGGAGGACATGGTGGACACGGAGGACATGGAGGACATGGACCTCATGCTGTTGAGACTGAAAAAGCCAACACTGACGGTTACCATGGACACGATCATGGACATGGCGGCCATGGAGGACACGGAGGACACGGAGGACATGGAGGACATGGACCTCATGCTGTTGAGACTGAAACTGAGAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

114

Amino Acids

11.51

Weight (kDa)

6.28

Isoelectric Point (pI)

10.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 156, 267
AcoI YGGCCR 2 cut(s) 157, 268
AfiI CCNNNNNNNGG 1 cut(s) 91
AluBI AGCT 1 cut(s) 89
AluI AGCT 1 cut(s) 89
Alw26I GTCTC 3 cut(s) 73, 209, 320
AoxI GGCC 2 cut(s) 157, 268
ApeKI GCWGC 1 cut(s) 95
AspS9I GGNCC 2 cut(s) 200, 311
AvaII GGWCC 2 cut(s) 200, 311
BbvCI CCTCAGC 1 cut(s) 90
BbvI GCAGC 1 cut(s) 82
BcoDI GTCTC 3 cut(s) 73, 209, 320
BfaI CTAG 2 cut(s) 86, 343
BisI GCNGC 3 cut(s) 96, 157, 268
BlsI GCNGC 3 cut(s) 97, 158, 269
Bme18I GGWCC 2 cut(s) 200, 311
BmgT120I GGNCC 2 cut(s) 200, 311
Bpu10I CCTNAGC 2 cut(s) 63, 90
BsaI GGTCTC 1 cut(s) 73
BsaJI CCNNGG 4 cut(s) 133, 160, 244, 271
Bsc4I CCNNNNNNNGG 1 cut(s) 91
BseDI CCNNGG 4 cut(s) 133, 160, 244, 271
BseLI CCNNNNNNNGG 1 cut(s) 91
BseMII CTCAG 2 cut(s) 81, 327
BseRI GAGGAG 1 cut(s) 41
BseXI GCAGC 1 cut(s) 82
BshFI GGCC 2 cut(s) 159, 270
BslI CCNNNNNNNGG 1 cut(s) 91
BsmAI GTCTC 3 cut(s) 73, 209, 320
BsmI GAATGC 1 cut(s) 5
BsnI GGCC 2 cut(s) 159, 270
Bso31I GGTCTC 1 cut(s) 73
Bsp143I GATC 2 cut(s) 142, 253
Bsp19I CCATGG 4 cut(s) 133, 160, 244, 271
BspACI CCGC 2 cut(s) 156, 267
BspANI GGCC 2 cut(s) 159, 270
BspCNI CTCAG 2 cut(s) 82, 328
BspTNI GGTCTC 1 cut(s) 73
BssECI CCNNGG 4 cut(s) 133, 160, 244, 271
BssMI GATC 2 cut(s) 142, 253
BssT1I CCWWGG 4 cut(s) 133, 160, 244, 271
Bst4CI ACNGT 2 cut(s) 128, 239
BstDEI CTNAG 3 cut(s) 63, 90, 336
BstDSI CCRYGG 4 cut(s) 133, 160, 244, 271
BstEII GGTNACC 2 cut(s) 128, 239
BstENI CCTNNNNNAGG 1 cut(s) 89
BstKTI GATC 2 cut(s) 145, 256
BstMAI GTCTC 3 cut(s) 73, 209, 320
BstMBI GATC 2 cut(s) 142, 253
BstMWI GCNNNNNNNGC 1 cut(s) 95
BstPI GGTNACC 2 cut(s) 128, 239
BstV1I GCAGC 1 cut(s) 82
BsuRI GGCC 2 cut(s) 159, 270
BtgI CCRYGG 4 cut(s) 133, 160, 244, 271
BtsIMutI CAGTG 2 cut(s) 120, 231
Cfr13I GGNCC 2 cut(s) 200, 311
CviJI RGCY 6 cut(s) 74, 89, 95, 159, 227, 270
CviKI_1 RGCY 6 cut(s) 74, 89, 95, 159, 227, 270
DdeI CTNAG 3 cut(s) 63, 90, 336
DpnI GATC 2 cut(s) 144, 255
DpnII GATC 2 cut(s) 142, 253
EaeI YGGCCR 2 cut(s) 157, 268
Eco130I CCWWGG 4 cut(s) 133, 160, 244, 271
Eco31I GGTCTC 1 cut(s) 73
Eco47I GGWCC 2 cut(s) 200, 311
Eco91I GGTNACC 2 cut(s) 128, 239
EcoNI CCTNNNNNAGG 1 cut(s) 89
EcoO65I GGTNACC 2 cut(s) 128, 239
EcoT14I CCWWGG 4 cut(s) 133, 160, 244, 271
ErhI CCWWGG 4 cut(s) 133, 160, 244, 271
Fnu4HI GCNGC 3 cut(s) 96, 157, 268
Fsp4HI GCNGC 3 cut(s) 96, 157, 268
FspBI CTAG 2 cut(s) 86, 343
GluI GCNGC 3 cut(s) 96, 157, 268
HaeIII GGCC 2 cut(s) 159, 270
Hpy166II GTNNAC 1 cut(s) 176
Hpy188III TCNNGA 1 cut(s) 80
Hpy8I GTNNAC 1 cut(s) 176
HpyCH4III ACNGT 2 cut(s) 128, 239
HpyF10VI GCNNNNNNNGC 1 cut(s) 95
HpyF3I CTNAG 3 cut(s) 63, 90, 336
Kzo9I GATC 2 cut(s) 142, 253
Lsp1109I GCAGC 1 cut(s) 82
MaeI CTAG 2 cut(s) 86, 343
MaeIII GTNAC 3 cut(s) 80, 128, 239
MalI GATC 2 cut(s) 144, 255
MboI GATC 2 cut(s) 142, 253
MboII GAAGA 1 cut(s) 14
MslI CAYNNNNRTG 4 cut(s) 144, 150, 255, 261
Mva1269I GAATGC 1 cut(s) 5
MwoI GCNNNNNNNGC 1 cut(s) 95
NcoI CCATGG 4 cut(s) 133, 160, 244, 271
NdeII GATC 2 cut(s) 142, 253
NmeAIII GCCGAG 1 cut(s) 50
NmuCI GTSAC 1 cut(s) 80
PctI GAATGC 1 cut(s) 5
PkrI GCNGC 3 cut(s) 97, 158, 269
PspEI GGTNACC 2 cut(s) 128, 239
PspPI GGNCC 2 cut(s) 200, 311
RseI CAYNNNNRTG 4 cut(s) 144, 150, 255, 261
SatI GCNGC 3 cut(s) 96, 157, 268
Sau3AI GATC 2 cut(s) 142, 253
Sau96I GGNCC 2 cut(s) 200, 311
SetI ASST 5 cut(s) 69, 87, 91, 205, 316
SinI GGWCC 2 cut(s) 200, 311
SmiMI CAYNNNNRTG 4 cut(s) 144, 150, 255, 261
SsiI CCGC 2 cut(s) 156, 267
SspMI CTAG 2 cut(s) 86, 343
StyI CCWWGG 4 cut(s) 133, 160, 244, 271
TaaI ACNGT 2 cut(s) 128, 239
TauI GCSGC 2 cut(s) 159, 270
TscAI CASTG 2 cut(s) 127, 238
TseFI GTSAC 1 cut(s) 80
TseI GCWGC 1 cut(s) 95
Tsp45I GTSAC 1 cut(s) 80
TspGWI ACGGA 3 cut(s) 195, 297, 306
TspRI CASTG 2 cut(s) 127, 238
VpaK11BI GGWCC 2 cut(s) 200, 311
XagI CCTNNNNNAGG 1 cut(s) 89
XcmI CCANNNNNNNNNTGG 1 cut(s) 167
XspI CTAG 2 cut(s) 86, 343
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.