FvH4_6g21670

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb6
OG0000866
Physical Location & Seq
Reverse (-)
15226116 .. 15227062
947 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_6g21670.t1

Sequence Viewer

Length: 243 bp
ATGGCATTCTCAAAGACTTTTCTTCTTGTCGCCCTTGCCTTTGCTGTTCTCCTCATCTCTGCTGAGGTCTCGGCTCACCGTGACCTAGCTGAGACTACCACTGCTACTCAGAAAGCCAACACTGATGGCTACCACGGACACGACCATGGATGGCACGGTGGACACGGAGGACATGGTGGACACGGAGGACATGGTGGTCATCACGGAGGGCATGGACCTCATGATGTTGAGACTGAGAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

8.28

Weight (kDa)

6.18

Isoelectric Point (pI)

14.87

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GRP PF07172 1 - 72 5.5e-11 Glycine rich protein family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 195
AluBI AGCT 1 cut(s) 89
AluI AGCT 1 cut(s) 89
Alw26I GTCTC 3 cut(s) 73, 86, 224
AspS9I GGNCC 1 cut(s) 215
AsuHPI GGTGA 1 cut(s) 68
AvaII GGWCC 1 cut(s) 215
BbvCI CCTCAGC 1 cut(s) 63
BccI CCATC 2 cut(s) 119, 144
BcoDI GTCTC 3 cut(s) 73, 86, 224
BfaI CTAG 2 cut(s) 86, 241
Bme18I GGWCC 1 cut(s) 215
BmgT120I GGNCC 1 cut(s) 215
Bpu10I CCTNAGC 1 cut(s) 63
BsaI GGTCTC 1 cut(s) 73
BsaJI CCNNGG 2 cut(s) 133, 145
BseDI CCNNGG 2 cut(s) 133, 145
BseGI GGATG 1 cut(s) 155
BseMII CTCAG 4 cut(s) 54, 81, 122, 225
BseRI GAGGAG 1 cut(s) 41
BsmAI GTCTC 3 cut(s) 73, 86, 224
BsmI GAATGC 1 cut(s) 5
Bso31I GGTCTC 1 cut(s) 73
Bsp19I CCATGG 1 cut(s) 145
BspCNI CTCAG 4 cut(s) 55, 82, 121, 226
BspHI TCATGA 1 cut(s) 220
BspTNI GGTCTC 1 cut(s) 73
BssECI CCNNGG 2 cut(s) 133, 145
BssT1I CCWWGG 1 cut(s) 145
Bst4CI ACNGT 2 cut(s) 80, 158
BstDEI CTNAG 4 cut(s) 63, 90, 108, 234
BstDSI CCRYGG 2 cut(s) 133, 145
BstF5I GGATG 1 cut(s) 155
BstMAI GTCTC 3 cut(s) 73, 86, 224
BtgI CCRYGG 2 cut(s) 133, 145
BtsCI GGATG 1 cut(s) 155
BtsI GCAGTG 1 cut(s) 99
BtsIMutI CAGTG 2 cut(s) 99, 120
CciI TCATGA 1 cut(s) 220
Cfr13I GGNCC 1 cut(s) 215
CviAII CATG 5 cut(s) 146, 173, 191, 212, 221
CviJI RGCY 4 cut(s) 74, 89, 116, 129
CviKI_1 RGCY 4 cut(s) 74, 89, 116, 129
DdeI CTNAG 4 cut(s) 63, 90, 108, 234
DrdI GACNNNNNNGTC 1 cut(s) 195
DseDI GACNNNNNNGTC 1 cut(s) 195
Eco130I CCWWGG 1 cut(s) 145
Eco31I GGTCTC 1 cut(s) 73
Eco47I GGWCC 1 cut(s) 215
EcoT14I CCWWGG 1 cut(s) 145
ErhI CCWWGG 1 cut(s) 145
FaeI CATG 5 cut(s) 149, 176, 194, 215, 224
FaiI YATR 5 cut(s) 147, 174, 192, 213, 222
FatI CATG 5 cut(s) 145, 172, 190, 211, 220
FokI GGATG 1 cut(s) 162
FspBI CTAG 2 cut(s) 86, 241
Hin1II CATG 5 cut(s) 149, 176, 194, 215, 224
HphI GGTGA 1 cut(s) 68
Hpy166II GTNNAC 2 cut(s) 161, 179
Hpy188I TCNGA 1 cut(s) 111
Hpy188III TCNNGA 1 cut(s) 221
Hpy8I GTNNAC 2 cut(s) 161, 179
HpyCH4III ACNGT 2 cut(s) 80, 158
HpyF3I CTNAG 4 cut(s) 63, 90, 108, 234
Hsp92II CATG 5 cut(s) 149, 176, 194, 215, 224
MaeI CTAG 2 cut(s) 86, 241
MaeIII GTNAC 1 cut(s) 80
MboII GAAGA 1 cut(s) 14
MnlI CCTC 6 cut(s) 58, 62, 161, 179, 200, 228
MslI CAYNNNNRTG 1 cut(s) 144
Mva1269I GAATGC 1 cut(s) 5
NcoI CCATGG 1 cut(s) 145
NlaIII CATG 5 cut(s) 149, 176, 194, 215, 224
NmeAIII GCCGAG 1 cut(s) 50
NmuCI GTSAC 1 cut(s) 80
PagI TCATGA 1 cut(s) 220
PctI GAATGC 1 cut(s) 5
PspPI GGNCC 1 cut(s) 215
RseI CAYNNNNRTG 1 cut(s) 144
Sau96I GGNCC 1 cut(s) 215
SetI ASST 4 cut(s) 69, 87, 91, 220
SinI GGWCC 1 cut(s) 215
SmiMI CAYNNNNRTG 1 cut(s) 144
SspMI CTAG 2 cut(s) 86, 241
StyI CCWWGG 1 cut(s) 145
TaaI ACNGT 2 cut(s) 80, 158
TscAI CASTG 2 cut(s) 106, 127
TseFI GTSAC 1 cut(s) 80
Tsp45I GTSAC 1 cut(s) 80
TspGWI ACGGA 4 cut(s) 150, 180, 198, 219
TspRI CASTG 2 cut(s) 106, 127
VpaK11BI GGWCC 1 cut(s) 215
XspI CTAG 2 cut(s) 86, 241
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.