Rw5G026470

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
OG0000866
Physical Location & Seq
Reverse (-)
38306460 .. 38307447
988 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G026470.1

Sequence Viewer

Length: 255 bp
ATGGCATTCTCAAAGACTATTCTTCTCGTTGCCCTTGTCTTTGCTGTTCTCCTCATCTCCTCTGACGTCTCAGCTCATGAAAATTCTGACCACTTCCACGGCAACGATCATGGACATGGTGGCCATGGACATGGAGGACATGGACATGGAGGCGAAGGAGGACATGGACATGGAGGACACGGAGGACATGGTGGCCATGGAGGCCGTGGAGGGCACGGAGGGCATGGACCTGGTGCTCATGAAACTGAGAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

84

Amino Acids

8.23

Weight (kDa)

6.35

Isoelectric Point (pI)

8.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 69
AcoI YGGCCR 2 cut(s) 121, 193
AcsI RAATTY 1 cut(s) 82
AcyI GRCGYC 1 cut(s) 66
AjnI CCWGG 1 cut(s) 229
AluBI AGCT 1 cut(s) 74
AluI AGCT 1 cut(s) 74
Alw21I GWGCWC 1 cut(s) 238
Alw26I GTCTC 1 cut(s) 73
AoxI GGCC 3 cut(s) 121, 193, 202
ApoI RAATTY 1 cut(s) 82
AspS9I GGNCC 1 cut(s) 227
AvaII GGWCC 1 cut(s) 227
BaeGI GKGCMC 1 cut(s) 216
BalI TGGCCA 2 cut(s) 123, 195
Bbv12I GWGCWC 1 cut(s) 238
BceAI ACGGC 2 cut(s) 115, 189
BciT130I CCWGG 1 cut(s) 231
BcoDI GTCTC 1 cut(s) 73
BglI GCCNNNNNGGC 1 cut(s) 201
Bme1390I CCNGG 1 cut(s) 231
Bme18I GGWCC 1 cut(s) 227
BmgT120I GGNCC 1 cut(s) 227
BmrFI CCNGG 1 cut(s) 231
BsaHI GRCGYC 1 cut(s) 66
BsaJI CCNNGG 4 cut(s) 97, 124, 196, 205
BseBI CCWGG 1 cut(s) 231
BseDI CCNNGG 4 cut(s) 97, 124, 196, 205
BseMII CTCAG 2 cut(s) 84, 237
BseRI GAGGAG 2 cut(s) 41, 49
BseSI GKGCMC 1 cut(s) 216
BshFI GGCC 3 cut(s) 123, 195, 204
BsiHKAI GWGCWC 1 cut(s) 238
BsmAI GTCTC 1 cut(s) 73
BsmBI CGTCTC 1 cut(s) 73
BsmI GAATGC 1 cut(s) 5
BsnI GGCC 3 cut(s) 123, 195, 204
Bsp1286I GDGCHC 2 cut(s) 216, 238
Bsp143I GATC 1 cut(s) 106
Bsp19I CCATGG 2 cut(s) 124, 196
BspANI GGCC 3 cut(s) 123, 195, 204
BspCNI CTCAG 2 cut(s) 83, 238
BspHI TCATGA 2 cut(s) 76, 238
BssECI CCNNGG 4 cut(s) 97, 124, 196, 205
BssMI GATC 1 cut(s) 106
BssNI GRCGYC 1 cut(s) 66
BssT1I CCWWGG 2 cut(s) 124, 196
Bst2UI CCWGG 1 cut(s) 231
BstACI GRCGYC 1 cut(s) 66
BstDEI CTNAG 2 cut(s) 70, 246
BstDSI CCRYGG 4 cut(s) 97, 124, 196, 205
BstKTI GATC 1 cut(s) 109
BstMAI GTCTC 1 cut(s) 73
BstMBI GATC 1 cut(s) 106
BstMWI GCNNNNNNNGC 2 cut(s) 201, 220
BstNI CCWGG 1 cut(s) 231
BstSCI CCNGG 1 cut(s) 229
BstSLI GKGCMC 1 cut(s) 216
BstXI CCANNNNNNTGG 1 cut(s) 131
BsuRI GGCC 3 cut(s) 123, 195, 204
BtgI CCRYGG 4 cut(s) 97, 124, 196, 205
CciI TCATGA 2 cut(s) 76, 238
Cfr13I GGNCC 1 cut(s) 227
CsiI ACCWGGT 1 cut(s) 229
CviJI RGCY 4 cut(s) 74, 123, 195, 204
CviKI_1 RGCY 4 cut(s) 74, 123, 195, 204
DdeI CTNAG 2 cut(s) 70, 246
DpnI GATC 1 cut(s) 108
DpnII GATC 1 cut(s) 106
EaeI YGGCCR 2 cut(s) 121, 193
Eco130I CCWWGG 2 cut(s) 124, 196
Eco47I GGWCC 1 cut(s) 227
EcoRII CCWGG 1 cut(s) 229
EcoT14I CCWWGG 2 cut(s) 124, 196
ErhI CCWWGG 2 cut(s) 124, 196
Esp3I CGTCTC 1 cut(s) 73
HaeIII GGCC 3 cut(s) 123, 195, 204
Hin1I GRCGYC 1 cut(s) 66
Hpy188I TCNGA 2 cut(s) 64, 88
Hpy188III TCNNGA 2 cut(s) 77, 239
HpyAV CCTTC 1 cut(s) 149
HpyCH4IV ACGT 1 cut(s) 66
HpyF10VI GCNNNNNNNGC 2 cut(s) 201, 220
HpyF3I CTNAG 2 cut(s) 70, 246
HpySE526I ACGT 1 cut(s) 66
Hsp92I GRCGYC 1 cut(s) 66
Kzo9I GATC 1 cut(s) 106
LpnPI CCDG 2 cut(s) 216, 243
MabI ACCWGGT 1 cut(s) 229
MaeII ACGT 1 cut(s) 66
MalI GATC 1 cut(s) 108
MboI GATC 1 cut(s) 106
MboII GAAGA 1 cut(s) 14
MhlI GDGCHC 2 cut(s) 216, 238
MlsI TGGCCA 2 cut(s) 123, 195
MluCI AATT 2 cut(s) 82, 250
MluNI TGGCCA 2 cut(s) 123, 195
Mox20I TGGCCA 2 cut(s) 123, 195
MscI TGGCCA 2 cut(s) 123, 195
MslI CAYNNNNRTG 4 cut(s) 114, 129, 144, 168
Msp20I TGGCCA 2 cut(s) 123, 195
MspR9I CCNGG 1 cut(s) 231
Mva1269I GAATGC 1 cut(s) 5
MvaI CCWGG 1 cut(s) 231
MwoI GCNNNNNNNGC 2 cut(s) 201, 220
NcoI CCATGG 2 cut(s) 124, 196
NdeII GATC 1 cut(s) 106
PagI TCATGA 2 cut(s) 76, 238
PctI GAATGC 1 cut(s) 5
Psp6I CCWGG 1 cut(s) 229
PspGI CCWGG 1 cut(s) 229
PspPI GGNCC 1 cut(s) 227
RseI CAYNNNNRTG 4 cut(s) 114, 129, 144, 168
Sau3AI GATC 1 cut(s) 106
Sau96I GGNCC 1 cut(s) 227
ScrFI CCNGG 1 cut(s) 231
SduI GDGCHC 2 cut(s) 216, 238
SetI ASST 3 cut(s) 69, 76, 232
SexAI ACCWGGT 1 cut(s) 229
SfiI GGCCNNNNNGGCC 1 cut(s) 201
SinI GGWCC 1 cut(s) 227
SmiMI CAYNNNNRTG 4 cut(s) 114, 129, 144, 168
Sse9I AATT 2 cut(s) 82, 250
StyD4I CCNGG 1 cut(s) 229
StyI CCWWGG 2 cut(s) 124, 196
TaiI ACGT 1 cut(s) 69
TasI AATT 2 cut(s) 82, 250
TspDTI ATGAA 2 cut(s) 93, 255
TspGWI ACGGA 2 cut(s) 195, 231
VpaK11BI GGWCC 1 cut(s) 227
XapI RAATTY 1 cut(s) 82
XcmI CCANNNNNNNNNTGG 1 cut(s) 203
ZraI GACGTC 1 cut(s) 67
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.