Rroxscaffold_1G00038730

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
56239353 .. 56240178
826 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00038730.1

Sequence Viewer

Length: 240 bp
ATGGCATTCTCAAAGACTATTCTTCTCGTTGCCCTTGTCTTTGCTGTTCTTCTCATCTCCTCTGAGGTCTCAGCTCATGAAAATTCTGACCACTTCCACGGCGACGATCATGGACATGGTGGCCATGGACATGGAGGACATGGACATGGAGGCGAAGGAGGACATGGAGGACACGGAGGACATGGTGGCCATGGAGGGCACGGAGGGCATGGACCTGGTGCTCATGAATCTGAGAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

79

Amino Acids

7.77

Weight (kDa)

6.09

Isoelectric Point (pI)

15.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 2 cut(s) 121, 187
AcsI RAATTY 1 cut(s) 82
AjnI CCWGG 1 cut(s) 214
AluBI AGCT 1 cut(s) 74
AluI AGCT 1 cut(s) 74
Alw21I GWGCWC 1 cut(s) 223
Alw26I GTCTC 1 cut(s) 73
AoxI GGCC 2 cut(s) 121, 187
ApoI RAATTY 1 cut(s) 82
AspS9I GGNCC 1 cut(s) 212
AvaII GGWCC 1 cut(s) 212
BaeGI GKGCMC 1 cut(s) 201
BalI TGGCCA 2 cut(s) 123, 189
Bbv12I GWGCWC 1 cut(s) 223
BceAI ACGGC 1 cut(s) 115
BciT130I CCWGG 1 cut(s) 216
BcoDI GTCTC 1 cut(s) 73
Bme1390I CCNGG 1 cut(s) 216
Bme18I GGWCC 1 cut(s) 212
BmgT120I GGNCC 1 cut(s) 212
BmrFI CCNGG 1 cut(s) 216
BsaI GGTCTC 1 cut(s) 73
BsaJI CCNNGG 3 cut(s) 97, 124, 190
BseBI CCWGG 1 cut(s) 216
BseDI CCNNGG 3 cut(s) 97, 124, 190
BseMII CTCAG 3 cut(s) 54, 84, 222
BseRI GAGGAG 1 cut(s) 49
BseSI GKGCMC 1 cut(s) 201
BshFI GGCC 2 cut(s) 123, 189
BsiHKAI GWGCWC 1 cut(s) 223
BsmAI GTCTC 1 cut(s) 73
BsmI GAATGC 1 cut(s) 5
BsnI GGCC 2 cut(s) 123, 189
Bso31I GGTCTC 1 cut(s) 73
Bsp1286I GDGCHC 2 cut(s) 201, 223
Bsp143I GATC 1 cut(s) 106
Bsp19I CCATGG 2 cut(s) 124, 190
BspANI GGCC 2 cut(s) 123, 189
BspCNI CTCAG 3 cut(s) 55, 83, 223
BspHI TCATGA 2 cut(s) 76, 223
BspTNI GGTCTC 1 cut(s) 73
BssECI CCNNGG 3 cut(s) 97, 124, 190
BssMI GATC 1 cut(s) 106
BssT1I CCWWGG 2 cut(s) 124, 190
Bst2UI CCWGG 1 cut(s) 216
BstDEI CTNAG 3 cut(s) 63, 70, 231
BstDSI CCRYGG 3 cut(s) 97, 124, 190
BstKTI GATC 1 cut(s) 109
BstMAI GTCTC 1 cut(s) 73
BstMBI GATC 1 cut(s) 106
BstMWI GCNNNNNNNGC 1 cut(s) 205
BstNI CCWGG 1 cut(s) 216
BstSCI CCNGG 1 cut(s) 214
BstSLI GKGCMC 1 cut(s) 201
BstXI CCANNNNNNTGG 1 cut(s) 131
BsuRI GGCC 2 cut(s) 123, 189
BtgI CCRYGG 3 cut(s) 97, 124, 190
CciI TCATGA 2 cut(s) 76, 223
Cfr13I GGNCC 1 cut(s) 212
CsiI ACCWGGT 1 cut(s) 214
CviJI RGCY 3 cut(s) 74, 123, 189
CviKI_1 RGCY 3 cut(s) 74, 123, 189
DdeI CTNAG 3 cut(s) 63, 70, 231
DpnI GATC 1 cut(s) 108
DpnII GATC 1 cut(s) 106
EaeI YGGCCR 2 cut(s) 121, 187
Eco130I CCWWGG 2 cut(s) 124, 190
Eco31I GGTCTC 1 cut(s) 73
Eco47I GGWCC 1 cut(s) 212
EcoRII CCWGG 1 cut(s) 214
EcoT14I CCWWGG 2 cut(s) 124, 190
ErhI CCWWGG 2 cut(s) 124, 190
HaeIII GGCC 2 cut(s) 123, 189
HinfI GANTC 1 cut(s) 227
Hpy188I TCNGA 3 cut(s) 64, 88, 232
Hpy188III TCNNGA 2 cut(s) 77, 224
Hpy99I CGWCG 1 cut(s) 107
HpyAV CCTTC 1 cut(s) 149
HpyF10VI GCNNNNNNNGC 1 cut(s) 205
HpyF3I CTNAG 3 cut(s) 63, 70, 231
Kzo9I GATC 1 cut(s) 106
LpnPI CCDG 2 cut(s) 201, 228
MabI ACCWGGT 1 cut(s) 214
MalI GATC 1 cut(s) 108
MboI GATC 1 cut(s) 106
MboII GAAGA 2 cut(s) 14, 41
MhlI GDGCHC 2 cut(s) 201, 223
MlsI TGGCCA 2 cut(s) 123, 189
MluCI AATT 2 cut(s) 82, 235
MluNI TGGCCA 2 cut(s) 123, 189
MnlI CCTC 9 cut(s) 58, 70, 128, 143, 152, 161, 170, 188, 197
Mox20I TGGCCA 2 cut(s) 123, 189
MscI TGGCCA 2 cut(s) 123, 189
MslI CAYNNNNRTG 3 cut(s) 114, 129, 144
Msp20I TGGCCA 2 cut(s) 123, 189
MspR9I CCNGG 1 cut(s) 216
Mva1269I GAATGC 1 cut(s) 5
MvaI CCWGG 1 cut(s) 216
MwoI GCNNNNNNNGC 1 cut(s) 205
NcoI CCATGG 2 cut(s) 124, 190
NdeII GATC 1 cut(s) 106
PagI TCATGA 2 cut(s) 76, 223
PctI GAATGC 1 cut(s) 5
PfeI GAWTC 1 cut(s) 227
Psp6I CCWGG 1 cut(s) 214
PspGI CCWGG 1 cut(s) 214
PspPI GGNCC 1 cut(s) 212
RseI CAYNNNNRTG 3 cut(s) 114, 129, 144
Sau3AI GATC 1 cut(s) 106
Sau96I GGNCC 1 cut(s) 212
ScrFI CCNGG 1 cut(s) 216
SduI GDGCHC 2 cut(s) 201, 223
SetI ASST 3 cut(s) 69, 76, 217
SexAI ACCWGGT 1 cut(s) 214
SinI GGWCC 1 cut(s) 212
SmiMI CAYNNNNRTG 3 cut(s) 114, 129, 144
Sse9I AATT 2 cut(s) 82, 235
StyD4I CCNGG 1 cut(s) 214
StyI CCWWGG 2 cut(s) 124, 190
TasI AATT 2 cut(s) 82, 235
TfiI GAWTC 1 cut(s) 227
TspDTI ATGAA 2 cut(s) 93, 240
TspGWI ACGGA 2 cut(s) 189, 216
VpaK11BI GGWCC 1 cut(s) 212
XapI RAATTY 1 cut(s) 82
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.