Rroxscaffold_4G00313780

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
OG0000866
Physical Location & Seq
Reverse (-)
37550339 .. 37551032
694 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00313780.1

Sequence Viewer

Length: 252 bp
ATGGCATTCTCAAAGACTTTTCTTCTTGTCGCCCTTGCCTTTGCTGTTCTCCTCATCTCTGCTGAGGTCTCGGCTCATCGTGACCTAGCTGAGGCTACCACTACTACTCAAAAAGCCAACACTGACGGTTACCACGGACACGATCATGGACATGGCGGCCATGGAGGACATGGTGGACATGGAGGACATGGTGGACACGGAGGACACGGAGGACATGGACCTCATGCTGTTGAGACTGAAACTGAGAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

83

Amino Acids

8.39

Weight (kDa)

6.18

Isoelectric Point (pI)

12.92

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GRP PF07172 1 - 73 5.5e-11 Glycine rich protein family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 156
AcoI YGGCCR 1 cut(s) 157
AfiI CCNNNNNNNGG 1 cut(s) 91
AluBI AGCT 1 cut(s) 89
AluI AGCT 1 cut(s) 89
Alw26I GTCTC 2 cut(s) 73, 227
AoxI GGCC 1 cut(s) 157
AspS9I GGNCC 1 cut(s) 218
AvaII GGWCC 1 cut(s) 218
BbvCI CCTCAGC 2 cut(s) 63, 90
BcoDI GTCTC 2 cut(s) 73, 227
BfaI CTAG 2 cut(s) 86, 250
BisI GCNGC 1 cut(s) 157
BlsI GCNGC 1 cut(s) 158
Bme18I GGWCC 1 cut(s) 218
BmgT120I GGNCC 1 cut(s) 218
Bpu10I CCTNAGC 2 cut(s) 63, 90
BsaI GGTCTC 1 cut(s) 73
BsaJI CCNNGG 2 cut(s) 133, 160
Bsc4I CCNNNNNNNGG 1 cut(s) 91
BseDI CCNNGG 2 cut(s) 133, 160
BseLI CCNNNNNNNGG 1 cut(s) 91
BseMII CTCAG 3 cut(s) 54, 81, 234
BseRI GAGGAG 1 cut(s) 41
BshFI GGCC 1 cut(s) 159
BslI CCNNNNNNNGG 1 cut(s) 91
BsmAI GTCTC 2 cut(s) 73, 227
BsmI GAATGC 1 cut(s) 5
BsnI GGCC 1 cut(s) 159
Bso31I GGTCTC 1 cut(s) 73
Bsp143I GATC 1 cut(s) 142
Bsp19I CCATGG 1 cut(s) 160
BspACI CCGC 1 cut(s) 156
BspANI GGCC 1 cut(s) 159
BspCNI CTCAG 3 cut(s) 55, 82, 235
BspTNI GGTCTC 1 cut(s) 73
BssECI CCNNGG 2 cut(s) 133, 160
BssMI GATC 1 cut(s) 142
BssT1I CCWWGG 1 cut(s) 160
Bst4CI ACNGT 1 cut(s) 128
BstDEI CTNAG 3 cut(s) 63, 90, 243
BstDSI CCRYGG 2 cut(s) 133, 160
BstEII GGTNACC 1 cut(s) 128
BstENI CCTNNNNNAGG 1 cut(s) 89
BstKTI GATC 1 cut(s) 145
BstMAI GTCTC 2 cut(s) 73, 227
BstMBI GATC 1 cut(s) 142
BstPI GGTNACC 1 cut(s) 128
BsuRI GGCC 1 cut(s) 159
BtgI CCRYGG 2 cut(s) 133, 160
BtsIMutI CAGTG 1 cut(s) 120
Cfr13I GGNCC 1 cut(s) 218
CviAII CATG 8 cut(s) 146, 152, 161, 170, 179, 188, 215, 224
CviJI RGCY 5 cut(s) 74, 89, 95, 116, 159
CviKI_1 RGCY 5 cut(s) 74, 89, 95, 116, 159
DdeI CTNAG 3 cut(s) 63, 90, 243
DpnI GATC 1 cut(s) 144
DpnII GATC 1 cut(s) 142
EaeI YGGCCR 1 cut(s) 157
Eco130I CCWWGG 1 cut(s) 160
Eco31I GGTCTC 1 cut(s) 73
Eco47I GGWCC 1 cut(s) 218
Eco91I GGTNACC 1 cut(s) 128
EcoNI CCTNNNNNAGG 1 cut(s) 89
EcoO65I GGTNACC 1 cut(s) 128
EcoT14I CCWWGG 1 cut(s) 160
ErhI CCWWGG 1 cut(s) 160
FaeI CATG 8 cut(s) 149, 155, 164, 173, 182, 191, 218, 227
FaiI YATR 8 cut(s) 147, 153, 162, 171, 180, 189, 216, 225
FatI CATG 8 cut(s) 145, 151, 160, 169, 178, 187, 214, 223
Fnu4HI GCNGC 1 cut(s) 157
Fsp4HI GCNGC 1 cut(s) 157
FspBI CTAG 2 cut(s) 86, 250
GluI GCNGC 1 cut(s) 157
HaeIII GGCC 1 cut(s) 159
Hin1II CATG 8 cut(s) 149, 155, 164, 173, 182, 191, 218, 227
Hpy166II GTNNAC 2 cut(s) 176, 194
Hpy188III TCNNGA 1 cut(s) 80
Hpy8I GTNNAC 2 cut(s) 176, 194
HpyCH4III ACNGT 1 cut(s) 128
HpyF3I CTNAG 3 cut(s) 63, 90, 243
Hsp92II CATG 8 cut(s) 149, 155, 164, 173, 182, 191, 218, 227
Kzo9I GATC 1 cut(s) 142
MaeI CTAG 2 cut(s) 86, 250
MaeIII GTNAC 2 cut(s) 80, 128
MalI GATC 1 cut(s) 144
MboI GATC 1 cut(s) 142
MboII GAAGA 1 cut(s) 14
MnlI CCTC 8 cut(s) 58, 62, 85, 158, 176, 194, 203, 231
MslI CAYNNNNRTG 2 cut(s) 144, 150
Mva1269I GAATGC 1 cut(s) 5
NcoI CCATGG 1 cut(s) 160
NdeII GATC 1 cut(s) 142
NlaIII CATG 8 cut(s) 149, 155, 164, 173, 182, 191, 218, 227
NmeAIII GCCGAG 1 cut(s) 50
NmuCI GTSAC 1 cut(s) 80
PctI GAATGC 1 cut(s) 5
PkrI GCNGC 1 cut(s) 158
PspEI GGTNACC 1 cut(s) 128
PspPI GGNCC 1 cut(s) 218
RseI CAYNNNNRTG 2 cut(s) 144, 150
SatI GCNGC 1 cut(s) 157
Sau3AI GATC 1 cut(s) 142
Sau96I GGNCC 1 cut(s) 218
SetI ASST 4 cut(s) 69, 87, 91, 223
SinI GGWCC 1 cut(s) 218
SmiMI CAYNNNNRTG 2 cut(s) 144, 150
SsiI CCGC 1 cut(s) 156
SspMI CTAG 2 cut(s) 86, 250
StyI CCWWGG 1 cut(s) 160
TaaI ACNGT 1 cut(s) 128
TauI GCSGC 1 cut(s) 159
TscAI CASTG 1 cut(s) 127
TseFI GTSAC 1 cut(s) 80
Tsp45I GTSAC 1 cut(s) 80
TspGWI ACGGA 3 cut(s) 150, 213, 222
TspRI CASTG 1 cut(s) 127
VpaK11BI GGWCC 1 cut(s) 218
XagI CCTNNNNNAGG 1 cut(s) 89
XcmI CCANNNNNNNNNTGG 1 cut(s) 167
XspI CTAG 2 cut(s) 86, 250
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.