Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr13

Orthogroup ID

OG0000755

Physical Location & Seq

Genomic Coordinates Reverse (-)

8577213 .. 8577968

Gene Structure 756 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD13G1117500.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 123 bp

ATGGTGAAGTACTCAAGAGAGCCCGACAATATCACCAAGTCTTGCAAAGCAAGAGGCTCTGACCTGAGGGTTCATTTCAAGGTATTCGGGCTTTTTAAGTTTGGACAATTTGGTCAAGATTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003735 GO:0005198 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005730 GO:0005737 GO:0005773 GO:0005829 GO:0005840 GO:0005844 GO:0005911 GO:0009506 GO:0015934 GO:0016020 GO:0022625 GO:0022626 GO:0030054 GO:0031974 GO:0031981 GO:0032991 GO:0042788 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043233 GO:0044391 GO:0044422 GO:0044424 GO:0044428 GO:0044444 GO:0044445 GO:0044446 GO:0044464 GO:0055044 GO:0070013 GO:1990904

KEGG Pathways

Metabolic & Signaling

ko03010 map03010

Pfam Domains

Protein Families

Ribosomal_L22

Protein Analysis

41

Amino Acids

4.64

Weight (kDa)

9.74

Isoelectric Point (pI)

29.3

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000755)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_7g31201 FvH4_7g31201 FvH4_7g31201 FvH4_7g31300 FvH4_7g31330
malus_domestica	MD01G1216700.v1.1 MD01G1216900.v1.1 MD01G1217000.v1.1 MD01G1217200.v1.1 MD01G1217400.v1.1 MD13G1117500.v1.1
prunus_persica	Prupe.2G308800_v2.0.a1
pyrus_communis	pycom01g22730 pycom01g22740 pycom01g22760
rosa_chinensis	RchiOBHm_Chr1g0380271 RchiOBHm_Chr1g0380281 RchiOBHm_Chr1g0380291 RchiOBHm_Chr1g0380351 RchiOBHm_Chr5g0056501 RchiOBHm_Chr5g0056511
rosa_laevigata	RLG00000013722 RLG00000026309 RLG00000026310 RLG00000026311 RLG00000026313
rosa_multiflora	Rmu_sc0000256.1_g000001 Rmu_sc0002387.1_g000005 Rmu_sc0002387.1_g000010 Rmu_sc0002387.1_g000012 Rmu_sc0003249.1_g000002 Rmu_sc0003249.1_g000003 Rmu_sc0003249.1_g000007 Rmu_sc0003249.1_g000008 Rmu_sc0003249.1_g000019 Rmu_sc0003249.1_g000030 Rmu_sc0005335.1_g000002 Rmu_sc0005335.1_g000010
rosa_roxburghii	Rroxscaffold_1G00023820 Rroxscaffold_2G00077310 Rroxscaffold_4G00279460 Rroxscaffold_4G00279470 Rroxscaffold_4G00279480 Rroxscaffold_4G00279500 Rroxscaffold_4G00279520 Rroxscaffold_4G00285960 Rroxscaffold_4G00330670
rosa_rugosa	Rorug01G0419800 Rorug01G0419900 Rorug01G0420000 Rorug01G0420000 Rorug01G0420100 Rorug05G0300400 Rorug05G0300500
rosa_samantha	Rh1AG444400 Rh1AG444600 Rh1AG444700 Rh1CG413000 Rh1CG413100 Rh1CG413300 Rh1CG413400 Rh1CG413500 Rh1CG413800 Rh1CG414000 Rh1CG414300 Rh2AG468600
rosa_wichuraiana	Rw1G001780 Rw1G038590 Rw1G038670 Rw1G038690 Rw5G015040

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	111
AfaI	GTAC	1 cut(s)	11
AgsI	TTSAA	1 cut(s)	79
AsuHPI	GGTGA	2 cut(s)	16, 25
AxyI	CCTNAGG	1 cut(s)	65
BanII	GRGCYC	1 cut(s)	24
BmcAI	AGTACT	1 cut(s)	11
Bse21I	CCTNAGG	1 cut(s)	65
BseMII	CTCAG	1 cut(s)	56
Bsp1286I	GDGCHC	1 cut(s)	24
BspCNI	CTCAG	1 cut(s)	57
BstDEI	CTNAG	1 cut(s)	65
Bsu36I	CCTNAGG	1 cut(s)	65
Csp6I	GTAC	1 cut(s)	10
CviJI	RGCY	3 cut(s)	22, 57, 91
CviKI_1	RGCY	3 cut(s)	22, 57, 91
CviQI	GTAC	1 cut(s)	10
DdeI	CTNAG	1 cut(s)	65
DrdI	GACNNNNNNGTC	1 cut(s)	111
DseDI	GACNNNNNNGTC	1 cut(s)	111
Eco24I	GRGCYC	1 cut(s)	24
Eco81I	CCTNAGG	1 cut(s)	65
EcoT38I	GRGCYC	1 cut(s)	24
FriOI	GRGCYC	1 cut(s)	24
HphI	GGTGA	2 cut(s)	16, 25
Hpy188I	TCNGA	1 cut(s)	61
Hpy188III	TCNNGA	2 cut(s)	15, 116
HpyCH4V	TGCA	1 cut(s)	45
HpyF3I	CTNAG	1 cut(s)	65
LpnPI	CCDG	1 cut(s)	77
MhlI	GDGCHC	1 cut(s)	24
MluCI	AATT	1 cut(s)	107
MnlI	CCTC	2 cut(s)	47, 60
MseI	TTAA	1 cut(s)	96
RsaI	GTAC	1 cut(s)	11
RsaNI	GTAC	1 cut(s)	10
SaqAI	TTAA	1 cut(s)	96
ScaI	AGTACT	1 cut(s)	11
SduI	GDGCHC	1 cut(s)	24
SetI	ASST	2 cut(s)	66, 84
SgeI	CNNG	8 cut(s)	27, 35, 49, 54, 63, 76, 91, 100
SmlI	CTYRAG	1 cut(s)	13
SmoI	CTYRAG	1 cut(s)	13
Sse9I	AATT	1 cut(s)	107
TasI	AATT	1 cut(s)	107
TatI	WGTACW	1 cut(s)	9
Tru1I	TTAA	1 cut(s)	96
Tru9I	TTAA	1 cut(s)	96
TspDTI	ATGAA	1 cut(s)	62
ZrmI	AGTACT	1 cut(s)	11

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.