Rmu_sc0003249.1_g000007

Cyclic nucleotide-gated ion channel 1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003249.1
OG0000755
Physical Location & Seq
Forward (+)
25729 .. 26322
594 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003249.1_g000007.1.cds

Sequence Viewer

Length: 594 bp
atggctttatttaggatacagaatggtgatatagaagaaaatggtggagaactaattcaaagggctaatggtactacttcaagtgcaagtttagcatcagtggactcggctgtcgataaggtctatagagctatggggcctggttttgaagggctaaagagttttaggaaaaccatgaaaatctattatggagttttgtctataggcttgagttccaataataaaattctttaccgccaggaattaacccagcacaggtggaataagatgcttcttgttctgtgtgtcatcgctctctcactggatcccttgttttgttatattcttgtggttaatgatgagaagaagtgccttggattcgacagaacattaggagctatagttagtgttctgcgatttgtcgtggatttcttttatgtgttttatatcatttatcaatttcgggctagtgttgtcactctttgttctgaatcatcgaaagaaggtgaactggttccacatactcgggcaacagcatggaaatatttgttgttgtacttcatattcgacatccttgtagttcttccacttccacaggtacggatttctacttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04626 map04626
Pfam Domains
Protein Families
Ion_trans cNMP_binding

Protein Analysis

197

Amino Acids

22.31

Weight (kDa)

8.86

Isoelectric Point (pI)

30.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 110
AciI CCGC 1 cut(s) 235
AclWI GGATC 2 cut(s) 299, 312
AcsI RAATTY 1 cut(s) 225
AfaI GTAC 3 cut(s) 73, 536, 579
AfiI CCNNNNNNNGG 1 cut(s) 255
AgsI TTSAA 3 cut(s) 59, 81, 149
AjnI CCWGG 2 cut(s) 139, 237
AluBI AGCT 2 cut(s) 131, 377
AluI AGCT 2 cut(s) 131, 377
AlwI GGATC 2 cut(s) 299, 312
Ama87I CYCGRG 1 cut(s) 504
AoxI GGCC 1 cut(s) 137
ApoI RAATTY 1 cut(s) 225
Asp700I GAANNNNTTC 2 cut(s) 54, 492
AspS9I GGNCC 1 cut(s) 137
AsuHPI GGTGA 2 cut(s) 38, 497
AvaI CYCGRG 1 cut(s) 504
BamHI GGATCC 1 cut(s) 304
BciT130I CCWGG 2 cut(s) 141, 239
BciVI GTATCC 1 cut(s) 9
BfaI CTAG 1 cut(s) 447
BfmI CTRYAG 3 cut(s) 124, 201, 378
BfuI GTATCC 1 cut(s) 9
Bme1390I CCNGG 2 cut(s) 141, 239
BmeT110I CYCGRG 1 cut(s) 504
BmgT120I GGNCC 1 cut(s) 137
BmiI GGNNCC 3 cut(s) 138, 306, 495
BmrFI CCNGG 2 cut(s) 141, 239
BmsI GCATC 2 cut(s) 104, 258
BpuEI CTTGAG 1 cut(s) 229
BsaJI CCNNGG 1 cut(s) 352
BsaXI ACNNNNNCTCC 2 cut(s) 366, 396
Bsc4I CCNNNNNNNGG 1 cut(s) 255
Bse1I ACTGG 2 cut(s) 306, 495
BseBI CCWGG 2 cut(s) 141, 239
BseDI CCNNGG 1 cut(s) 352
BseGI GGATG 1 cut(s) 549
BseLI CCNNNNNNNGG 1 cut(s) 255
BseNI ACTGG 2 cut(s) 306, 495
BseYI CCCAGC 1 cut(s) 249
BshFI GGCC 1 cut(s) 139
BsiHKCI CYCGRG 1 cut(s) 504
BslI CCNNNNNNNGG 1 cut(s) 255
BsnI GGCC 1 cut(s) 139
BsoBI CYCGRG 1 cut(s) 504
Bsp143I GATC 1 cut(s) 304
BspACI CCGC 1 cut(s) 235
BspANI GGCC 1 cut(s) 139
BspLI GGNNCC 3 cut(s) 138, 306, 495
BspPI GGATC 2 cut(s) 299, 312
BsrI ACTGG 2 cut(s) 306, 495
BssECI CCNNGG 1 cut(s) 352
BssMI GATC 1 cut(s) 304
BssT1I CCWWGG 1 cut(s) 352
Bst2UI CCWGG 2 cut(s) 141, 239
BstF5I GGATG 1 cut(s) 549
BstKTI GATC 1 cut(s) 307
BstMBI GATC 1 cut(s) 304
BstMWI GCNNNNNNNGC 1 cut(s) 92
BstNI CCWGG 2 cut(s) 141, 239
BstSCI CCNGG 2 cut(s) 139, 237
BstSFI CTRYAG 3 cut(s) 124, 201, 378
BstX2I RGATCY 1 cut(s) 304
BstYI RGATCY 1 cut(s) 304
BsuI GTATCC 1 cut(s) 9
BsuRI GGCC 1 cut(s) 139
BtgZI GCGATG 1 cut(s) 274
BtsCI GGATG 1 cut(s) 549
BtsIMutI CAGTG 2 cut(s) 105, 299
Cfr13I GGNCC 1 cut(s) 137
Csp6I GTAC 3 cut(s) 72, 535, 578
CviAII CATG 2 cut(s) 175, 516
CviJI RGCY 9 cut(s) 5, 65, 110, 131, 139, 154, 207, 377, 446
CviKI_1 RGCY 9 cut(s) 5, 65, 110, 131, 139, 154, 207, 377, 446
CviQI GTAC 3 cut(s) 72, 535, 578
DpnI GATC 1 cut(s) 306
DpnII GATC 1 cut(s) 304
DrdI GACNNNNNNGTC 1 cut(s) 110
DseDI GACNNNNNNGTC 1 cut(s) 110
Eco130I CCWWGG 1 cut(s) 352
Eco88I CYCGRG 1 cut(s) 504
EcoO109I RGGNCCY 1 cut(s) 137
EcoRII CCWGG 2 cut(s) 139, 237
EcoT14I CCWWGG 1 cut(s) 352
ErhI CCWWGG 1 cut(s) 352
FaeI CATG 2 cut(s) 178, 519
FatI CATG 2 cut(s) 174, 515
FokI GGATG 1 cut(s) 536
FspBI CTAG 1 cut(s) 447
GsaI CCCAGC 1 cut(s) 253
HaeIII GGCC 1 cut(s) 139
Hin1II CATG 2 cut(s) 178, 519
HinfI GANTC 3 cut(s) 104, 357, 470
HphI GGTGA 2 cut(s) 38, 497
Hpy166II GTNNAC 2 cut(s) 103, 488
Hpy188I TCNGA 1 cut(s) 469
Hpy8I GTNNAC 2 cut(s) 103, 488
HpyAV CCTTC 2 cut(s) 143, 476
HpyCH4V TGCA 1 cut(s) 86
HpyF10VI GCNNNNNNNGC 1 cut(s) 92
Hsp92II CATG 2 cut(s) 178, 519
Kzo9I GATC 1 cut(s) 304
LmnI GCTCC 1 cut(s) 374
LpnPI CCDG 9 cut(s) 126, 153, 224, 241, 251, 263, 287, 476, 560
LweI GCATC 2 cut(s) 104, 258
MaeI CTAG 1 cut(s) 447
MaeIII GTNAC 1 cut(s) 454
MalI GATC 1 cut(s) 306
MboI GATC 1 cut(s) 304
MboII GAAGA 3 cut(s) 47, 355, 554
MflI RGATCY 1 cut(s) 304
MluCI AATT 4 cut(s) 54, 225, 242, 437
MlyI GAGTC 1 cut(s) 98
MroXI GAANNNNTTC 2 cut(s) 54, 492
MseI TTAA 2 cut(s) 245, 333
MspR9I CCNGG 2 cut(s) 141, 239
MvaI CCWGG 2 cut(s) 141, 239
MwoI GCNNNNNNNGC 1 cut(s) 92
NdeII GATC 1 cut(s) 304
NlaIII CATG 2 cut(s) 178, 519
NlaIV GGNNCC 3 cut(s) 138, 306, 495
NmeAIII GCCGAG 1 cut(s) 86
NmuCI GTSAC 1 cut(s) 454
PdmI GAANNNNTTC 2 cut(s) 54, 492
PfeI GAWTC 2 cut(s) 357, 470
PleI GAGTC 1 cut(s) 98
PpsI GAGTC 1 cut(s) 98
Psp6I CCWGG 2 cut(s) 139, 237
PspFI CCCAGC 1 cut(s) 249
PspGI CCWGG 2 cut(s) 139, 237
PspN4I GGNNCC 3 cut(s) 138, 306, 495
PspPI GGNCC 1 cut(s) 137
PsuI RGATCY 1 cut(s) 304
RsaI GTAC 3 cut(s) 73, 536, 579
RsaNI GTAC 3 cut(s) 72, 535, 578
SaqAI TTAA 2 cut(s) 245, 333
Sau3AI GATC 1 cut(s) 304
Sau96I GGNCC 1 cut(s) 137
SchI GAGTC 1 cut(s) 98
ScrFI CCNGG 2 cut(s) 141, 239
SetI ASST 6 cut(s) 123, 133, 260, 379, 487, 579
SfaNI GCATC 2 cut(s) 104, 258
SfcI CTRYAG 3 cut(s) 124, 201, 378
SmlI CTYRAG 1 cut(s) 208
SmoI CTYRAG 1 cut(s) 208
Sse9I AATT 4 cut(s) 54, 225, 242, 437
SsiI CCGC 1 cut(s) 235
SspI AATATT 1 cut(s) 524
SspMI CTAG 1 cut(s) 447
StyD4I CCNGG 2 cut(s) 139, 237
StyI CCWWGG 1 cut(s) 352
TaqI TCGA 4 cut(s) 114, 360, 476, 546
TasI AATT 4 cut(s) 54, 225, 242, 437
TatI WGTACW 1 cut(s) 534
TfiI GAWTC 2 cut(s) 357, 470
Tru1I TTAA 2 cut(s) 245, 333
Tru9I TTAA 2 cut(s) 245, 333
TscAI CASTG 2 cut(s) 105, 306
TseFI GTSAC 1 cut(s) 454
Tsp45I GTSAC 1 cut(s) 454
TspDTI ATGAA 2 cut(s) 191, 529
TspRI CASTG 2 cut(s) 105, 306
XapI RAATTY 1 cut(s) 225
XmnI GAANNNNTTC 2 cut(s) 54, 492
XspI CTAG 1 cut(s) 447
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.