Rh2AG468600

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
OG0000755
Physical Location & Seq
Reverse (-)
68898765 .. 68903316
4552 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG468600.1

Sequence Viewer

Length: 183 bp
ATGCTACTACAGCATGACGAGAAAGTTTTGCAGCATGTCAACATGATCCTGCTGTTCCTATTTGGGAGACTTGGGAAATTGGCTGCTGCTGTGACGAAAAAAAAAGGGGTCAGAGGAGCCACTTGGACTTTTCTTCACACTCTTGCTGCTCAGTTGTGGAAGAAAGCAACCCATGTGCATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

60

Amino Acids

6.82

Weight (kDa)

10.73

Isoelectric Point (pI)

13.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 40
Alw26I GTCTC 1 cut(s) 61
AlwI GGATC 1 cut(s) 40
ApeKI GCWGC 4 cut(s) 31, 83, 86, 146
BbvI GCAGC 4 cut(s) 43, 70, 73, 133
BcoDI GTCTC 1 cut(s) 61
BfmI CTRYAG 1 cut(s) 8
BisI GCNGC 4 cut(s) 32, 84, 87, 147
BlsI GCNGC 4 cut(s) 33, 85, 88, 148
BmiI GGNNCC 1 cut(s) 118
BseMII CTCAG 1 cut(s) 164
BseRI GAGGAG 1 cut(s) 129
BseXI GCAGC 4 cut(s) 43, 70, 73, 133
BsmAI GTCTC 1 cut(s) 61
Bsp143I GATC 1 cut(s) 45
BspCNI CTCAG 1 cut(s) 163
BspLI GGNNCC 1 cut(s) 118
BspPI GGATC 1 cut(s) 40
BssMI GATC 1 cut(s) 45
BstDEI CTNAG 1 cut(s) 150
BstKTI GATC 1 cut(s) 48
BstMAI GTCTC 1 cut(s) 61
BstMBI GATC 1 cut(s) 45
BstMWI GCNNNNNNNGC 1 cut(s) 10
BstNSI RCATGY 1 cut(s) 38
BstSFI CTRYAG 1 cut(s) 8
BstV1I GCAGC 4 cut(s) 43, 70, 73, 133
CviAII CATG 4 cut(s) 14, 35, 43, 173
CviJI RGCY 2 cut(s) 83, 119
CviKI_1 RGCY 2 cut(s) 83, 119
DdeI CTNAG 1 cut(s) 150
DpnI GATC 1 cut(s) 47
DpnII GATC 1 cut(s) 45
FaeI CATG 4 cut(s) 17, 38, 46, 176
FaiI YATR 4 cut(s) 15, 36, 44, 174
FatI CATG 4 cut(s) 13, 34, 42, 172
Fnu4HI GCNGC 4 cut(s) 32, 84, 87, 147
Fsp4HI GCNGC 4 cut(s) 32, 84, 87, 147
GluI GCNGC 4 cut(s) 32, 84, 87, 147
Hin1II CATG 4 cut(s) 17, 38, 46, 176
HincII GTYRAC 1 cut(s) 40
HindII GTYRAC 1 cut(s) 40
Hpy166II GTNNAC 1 cut(s) 40
Hpy188I TCNGA 1 cut(s) 113
Hpy8I GTNNAC 1 cut(s) 40
HpyCH4V TGCA 2 cut(s) 31, 178
HpyF10VI GCNNNNNNNGC 1 cut(s) 10
HpyF3I CTNAG 1 cut(s) 150
Hsp92II CATG 4 cut(s) 17, 38, 46, 176
Kzo9I GATC 1 cut(s) 45
LmnI GCTCC 1 cut(s) 116
LpnPI CCDG 1 cut(s) 62
Lsp1109I GCAGC 4 cut(s) 43, 70, 73, 133
MaeIII GTNAC 1 cut(s) 91
MalI GATC 1 cut(s) 47
MboI GATC 1 cut(s) 45
MboII GAAGA 2 cut(s) 125, 172
MluCI AATT 1 cut(s) 77
MnlI CCTC 1 cut(s) 107
MseI TTAA 1 cut(s) 181
MwoI GCNNNNNNNGC 1 cut(s) 10
NdeII GATC 1 cut(s) 45
NlaIII CATG 4 cut(s) 17, 38, 46, 176
NlaIV GGNNCC 1 cut(s) 118
NmuCI GTSAC 1 cut(s) 91
NspI RCATGY 1 cut(s) 38
PkrI GCNGC 4 cut(s) 33, 85, 88, 148
PspN4I GGNNCC 1 cut(s) 118
SaqAI TTAA 1 cut(s) 181
SatI GCNGC 4 cut(s) 32, 84, 87, 147
Sau3AI GATC 1 cut(s) 45
SfcI CTRYAG 1 cut(s) 8
SgeI CNNG 8 cut(s) 26, 31, 47, 55, 61, 83, 135, 155
Sse9I AATT 1 cut(s) 77
TasI AATT 1 cut(s) 77
Tru1I TTAA 1 cut(s) 181
Tru9I TTAA 1 cut(s) 181
TseFI GTSAC 1 cut(s) 91
TseI GCWGC 4 cut(s) 31, 83, 86, 146
Tsp45I GTSAC 1 cut(s) 91
XceI RCATGY 1 cut(s) 38
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.