Rroxscaffold_2G00077310

Belongs to the universal ribosomal protein uL22 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0000755
Physical Location & Seq
Forward (+)
884640 .. 885656
1017 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00077310.1

Sequence Viewer

Length: 150 bp
ATGGTGAAGTACTCCAAGGAGCCTGATAATCCCACCAAGTCCTGCAAGGCCAGAGGCTCGGATCTGAGAGTTCATTTCAAGCCTGACACTCAATTGGCTCCCCGGAAATCAAGGAAAGGTCAAGCCCTACACAGTGGTGCATCTTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0008150 GO:0042592 GO:0048872 GO:0061484 GO:0065007 GO:0065008
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_L22

Protein Analysis

49

Amino Acids

5.4

Weight (kDa)

10.22

Isoelectric Point (pI)

13.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 69
AfaI GTAC 1 cut(s) 11
AgsI TTSAA 1 cut(s) 79
AleI CACNNNNGTG 1 cut(s) 135
AlwI GGATC 1 cut(s) 69
AoxI GGCC 1 cut(s) 48
AsuC2I CCSGG 1 cut(s) 103
AsuHPI GGTGA 1 cut(s) 16
BcnI CCSGG 1 cut(s) 103
BmcAI AGTACT 1 cut(s) 11
Bme1390I CCNGG 1 cut(s) 103
BmiI GGNNCC 2 cut(s) 21, 99
BmrFI CCNGG 1 cut(s) 103
BpuMI CCSGG 1 cut(s) 103
BsaJI CCNNGG 2 cut(s) 15, 101
BseDI CCNNGG 2 cut(s) 15, 101
BseMII CTCAG 1 cut(s) 56
BshFI GGCC 1 cut(s) 50
BsiSI CCGG 1 cut(s) 103
BsnI GGCC 1 cut(s) 50
Bsp143I GATC 1 cut(s) 61
BspANI GGCC 1 cut(s) 50
BspCNI CTCAG 1 cut(s) 57
BspLI GGNNCC 2 cut(s) 21, 99
BspPI GGATC 1 cut(s) 69
BssECI CCNNGG 2 cut(s) 15, 101
BssMI GATC 1 cut(s) 61
BssT1I CCWWGG 1 cut(s) 15
Bst4CI ACNGT 1 cut(s) 134
BstDEI CTNAG 1 cut(s) 65
BstKTI GATC 1 cut(s) 64
BstMBI GATC 1 cut(s) 61
BstSCI CCNGG 1 cut(s) 101
BstX2I RGATCY 1 cut(s) 61
BstYI RGATCY 1 cut(s) 61
BsuRI GGCC 1 cut(s) 50
BtsIMutI CAGTG 1 cut(s) 139
Csp6I GTAC 1 cut(s) 10
CviJI RGCY 6 cut(s) 22, 50, 57, 82, 98, 125
CviKI_1 RGCY 6 cut(s) 22, 50, 57, 82, 98, 125
CviQI GTAC 1 cut(s) 10
DdeI CTNAG 1 cut(s) 65
DpnI GATC 1 cut(s) 63
DpnII GATC 1 cut(s) 61
Eco130I CCWWGG 1 cut(s) 15
EcoT14I CCWWGG 1 cut(s) 15
ErhI CCWWGG 1 cut(s) 15
HaeIII GGCC 1 cut(s) 50
HapII CCGG 1 cut(s) 103
HpaII CCGG 1 cut(s) 103
HphI GGTGA 1 cut(s) 16
Hpy188I TCNGA 2 cut(s) 61, 66
Hpy188III TCNNGA 1 cut(s) 147
HpyCH4III ACNGT 1 cut(s) 134
HpyCH4V TGCA 2 cut(s) 45, 140
HpyF3I CTNAG 1 cut(s) 65
Kzo9I GATC 1 cut(s) 61
LmnI GCTCC 2 cut(s) 19, 103
LpnPI CCDG 5 cut(s) 36, 55, 64, 96, 116
MalI GATC 1 cut(s) 63
MboI GATC 1 cut(s) 61
MboII GAAGA 1 cut(s) 135
MfeI CAATTG 1 cut(s) 92
MflI RGATCY 1 cut(s) 61
MluCI AATT 1 cut(s) 92
MnlI CCTC 1 cut(s) 47
MslI CAYNNNNRTG 1 cut(s) 135
MspI CCGG 1 cut(s) 103
MspR9I CCNGG 1 cut(s) 103
MunI CAATTG 1 cut(s) 92
NciI CCSGG 1 cut(s) 103
NdeII GATC 1 cut(s) 61
NlaIV GGNNCC 2 cut(s) 21, 99
OliI CACNNNNGTG 1 cut(s) 135
PspN4I GGNNCC 2 cut(s) 21, 99
PsuI RGATCY 1 cut(s) 61
RsaI GTAC 1 cut(s) 11
RsaNI GTAC 1 cut(s) 10
RseI CAYNNNNRTG 1 cut(s) 135
Sau3AI GATC 1 cut(s) 61
ScaI AGTACT 1 cut(s) 11
ScrFI CCNGG 1 cut(s) 103
SetI ASST 1 cut(s) 121
SmiMI CAYNNNNRTG 1 cut(s) 135
Sse9I AATT 1 cut(s) 92
StyD4I CCNGG 1 cut(s) 101
StyI CCWWGG 1 cut(s) 15
TaaI ACNGT 1 cut(s) 134
TasI AATT 1 cut(s) 92
TatI WGTACW 1 cut(s) 9
TscAI CASTG 1 cut(s) 139
TspDTI ATGAA 1 cut(s) 62
TspRI CASTG 1 cut(s) 139
ZrmI AGTACT 1 cut(s) 11
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.