MD13G1184500.v1.1

Belongs to the peptidase A1 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr13
OG0000716
Physical Location & Seq
Reverse (-)
15651963 .. 15652184
222 bp
Loading structure...
UTR
Exon/CDS
Intron
MD13G1184500.v1.1.491

Sequence Viewer

Length: 222 bp
ATGTTCGGAGCAAATTCAATGGTATATATGAGCAATGATGTCTTATGTTTAGGGTTTGTGGATGGAGGTAAGAGGCCAAAGACTTCTATTGTGATTGGAGGGCACCAATTGGAGGACAATCTTCTACAGTTTGATCTGGCTACTTCTAGGCTTGGGTTCAGTTCCTCACTTTTGTTTAGACGTACAACTTGTGTGAACTTCAACTTCACTTCTAATGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
TAXi_C TAXi_N

Protein Analysis

74

Amino Acids

8.01

Weight (kDa)

7.82

Isoelectric Point (pI)

46.82

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TAXi_C PF14541 1 - 55 1.5e-20 Xylanase inhibitor C-terminal
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 102
AcsI RAATTY 1 cut(s) 13
AfaI GTAC 1 cut(s) 184
AfiI CCNNNNNNNGG 1 cut(s) 112
AgsI TTSAA 2 cut(s) 18, 202
AoxI GGCC 1 cut(s) 74
ApoI RAATTY 1 cut(s) 13
BaeGI GKGCMC 1 cut(s) 105
BanI GGYRCC 1 cut(s) 102
BccI CCATC 1 cut(s) 56
BfaI CTAG 1 cut(s) 147
BfmI CTRYAG 1 cut(s) 125
BmiI GGNNCC 1 cut(s) 104
Bsc4I CCNNNNNNNGG 1 cut(s) 112
Bse3DI GCAATG 1 cut(s) 40
BseGI GGATG 1 cut(s) 67
BseLI CCNNNNNNNGG 1 cut(s) 112
BseMI GCAATG 1 cut(s) 40
BseSI GKGCMC 1 cut(s) 105
BshFI GGCC 1 cut(s) 76
BshNI GGYRCC 1 cut(s) 102
BslI CCNNNNNNNGG 1 cut(s) 112
BsnI GGCC 1 cut(s) 76
Bsp1286I GDGCHC 1 cut(s) 105
Bsp143I GATC 1 cut(s) 133
BspANI GGCC 1 cut(s) 76
BspLI GGNNCC 1 cut(s) 104
BspT107I GGYRCC 1 cut(s) 102
BsrDI GCAATG 1 cut(s) 40
BssMI GATC 1 cut(s) 133
Bst4CI ACNGT 1 cut(s) 129
BstF5I GGATG 1 cut(s) 67
BstKTI GATC 1 cut(s) 136
BstMBI GATC 1 cut(s) 133
BstSFI CTRYAG 1 cut(s) 125
BstSLI GKGCMC 1 cut(s) 105
BsuRI GGCC 1 cut(s) 76
BtsCI GGATG 1 cut(s) 67
Csp6I GTAC 1 cut(s) 183
CviJI RGCY 3 cut(s) 76, 140, 151
CviKI_1 RGCY 3 cut(s) 76, 140, 151
CviQI GTAC 1 cut(s) 183
DpnI GATC 1 cut(s) 135
DpnII GATC 1 cut(s) 133
FaiI YATR 4 cut(s) 25, 27, 29, 46
FokI GGATG 1 cut(s) 74
FspBI CTAG 1 cut(s) 147
HaeIII GGCC 1 cut(s) 76
Hpy166II GTNNAC 1 cut(s) 196
Hpy188I TCNGA 1 cut(s) 8
Hpy8I GTNNAC 1 cut(s) 196
HpyCH4III ACNGT 1 cut(s) 129
HpyCH4IV ACGT 1 cut(s) 181
HpySE526I ACGT 1 cut(s) 181
Kzo9I GATC 1 cut(s) 133
LmnI GCTCC 1 cut(s) 8
LpnPI CCDG 1 cut(s) 122
MaeI CTAG 1 cut(s) 147
MaeII ACGT 1 cut(s) 181
MalI GATC 1 cut(s) 135
MboI GATC 1 cut(s) 133
MboII GAAGA 1 cut(s) 113
MfeI CAATTG 1 cut(s) 107
MhlI GDGCHC 1 cut(s) 105
MluCI AATT 2 cut(s) 13, 107
MnlI CCTC 5 cut(s) 59, 66, 92, 106, 175
MseI TTAA 1 cut(s) 220
MunI CAATTG 1 cut(s) 107
NdeII GATC 1 cut(s) 133
NlaIV GGNNCC 1 cut(s) 104
PspN4I GGNNCC 1 cut(s) 104
RsaI GTAC 1 cut(s) 184
RsaNI GTAC 1 cut(s) 183
SaqAI TTAA 1 cut(s) 220
Sau3AI GATC 1 cut(s) 133
SduI GDGCHC 1 cut(s) 105
SetI ASST 2 cut(s) 70, 184
SfcI CTRYAG 1 cut(s) 125
SgeI CNNG 4 cut(s) 149, 159, 164, 201
Sse9I AATT 2 cut(s) 13, 107
SspMI CTAG 1 cut(s) 147
TaaI ACNGT 1 cut(s) 129
TaiI ACGT 1 cut(s) 184
TasI AATT 2 cut(s) 13, 107
Tru1I TTAA 1 cut(s) 220
Tru9I TTAA 1 cut(s) 220
XapI RAATTY 1 cut(s) 13
XspI CTAG 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.