MD13G1184900.v1.1

aspartic-type endopeptidase activity

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr13
Physical Location & Seq
Reverse (-)
15706789 .. 15707103
315 bp
Loading structure...
UTR
Exon/CDS
Intron
MD13G1184900.v1.1.491

Sequence Viewer

Length: 315 bp
ATGGATGTGTCCAAGTCACTTACTTACACCTCATTACTCCTCAACCCTTTCACCACAGTCCCGGCTTACATGGAAGGCAAGCCTTTGGTTGAATATTTCATCAATGTAACGTTTATCAAAATGAACGGCCTTACATTGCCGTTAAATTCTTTGTTACTCGTCTTAGATCAAAACGGCCATGGTGGTACGAAAATTAGCACTGTTAATCCCTACACGGTGTTGGAAAGCTCAATCTTTAACACTCTCAATTGGGCATTTCTGAAAGTACTCCCTACTTCAATTCCTAGAATGGGATACATAGCGCCTTATGGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

105

Amino Acids

11.52

Weight (kDa)

7.98

Isoelectric Point (pI)

16.05

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TAXi_C PF14541 31 - 102 3.2e-15 Xylanase inhibitor C-terminal
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 110
AcoI YGGCCR 1 cut(s) 175
AcsI RAATTY 1 cut(s) 145
AfaI GTAC 2 cut(s) 187, 267
AfiI CCNNNNNNNGG 1 cut(s) 290
AgsI TTSAA 2 cut(s) 92, 279
AluBI AGCT 1 cut(s) 228
AluI AGCT 1 cut(s) 228
AoxI GGCC 2 cut(s) 127, 175
ApoI RAATTY 1 cut(s) 145
AspLEI GCGC 1 cut(s) 304
AsuC2I CCSGG 1 cut(s) 62
AsuHPI GGTGA 1 cut(s) 43
BceAI ACGGC 3 cut(s) 124, 142, 190
BciVI GTATCC 1 cut(s) 287
BcnI CCSGG 1 cut(s) 62
BfaI CTAG 1 cut(s) 285
BfoI RGCGCY 1 cut(s) 305
BfuI GTATCC 1 cut(s) 287
BmcAI AGTACT 1 cut(s) 267
Bme1390I CCNGG 1 cut(s) 62
BmrFI CCNGG 1 cut(s) 62
BpuMI CCSGG 1 cut(s) 62
BsaJI CCNNGG 1 cut(s) 178
Bsc4I CCNNNNNNNGG 1 cut(s) 290
Bse3DI GCAATG 1 cut(s) 134
BseDI CCNNGG 1 cut(s) 178
BseGI GGATG 1 cut(s) 10
BseLI CCNNNNNNNGG 1 cut(s) 290
BseMI GCAATG 1 cut(s) 134
BseRI GAGGAG 1 cut(s) 29
BshFI GGCC 2 cut(s) 129, 177
BsiSI CCGG 1 cut(s) 62
BslFI GGGAC 1 cut(s) 44
BslI CCNNNNNNNGG 1 cut(s) 290
BsmFI GGGAC 1 cut(s) 44
BsnI GGCC 2 cut(s) 129, 177
Bsp143I GATC 1 cut(s) 166
Bsp19I CCATGG 1 cut(s) 178
BspANI GGCC 2 cut(s) 129, 177
BsrDI GCAATG 1 cut(s) 134
BssECI CCNNGG 1 cut(s) 178
BssMI GATC 1 cut(s) 166
BssT1I CCWWGG 1 cut(s) 178
Bst4CI ACNGT 3 cut(s) 58, 202, 217
BstC8I GCNNGC 1 cut(s) 80
BstDEI CTNAG 1 cut(s) 163
BstDSI CCRYGG 1 cut(s) 178
BstF5I GGATG 1 cut(s) 10
BstH2I RGCGCY 1 cut(s) 305
BstHHI GCGC 1 cut(s) 304
BstKTI GATC 1 cut(s) 169
BstMBI GATC 1 cut(s) 166
BstSCI CCNGG 1 cut(s) 60
BsuI GTATCC 1 cut(s) 287
BsuRI GGCC 2 cut(s) 129, 177
BtgI CCRYGG 1 cut(s) 178
BtsCI GGATG 1 cut(s) 10
BtsIMutI CAGTG 1 cut(s) 198
Cac8I GCNNGC 1 cut(s) 80
CfoI GCGC 1 cut(s) 304
Csp6I GTAC 2 cut(s) 186, 266
CviAII CATG 2 cut(s) 70, 179
CviJI RGCY 5 cut(s) 65, 82, 129, 177, 228
CviKI_1 RGCY 5 cut(s) 65, 82, 129, 177, 228
CviQI GTAC 2 cut(s) 186, 266
DdeI CTNAG 1 cut(s) 163
DpnI GATC 1 cut(s) 168
DpnII GATC 1 cut(s) 166
EaeI YGGCCR 1 cut(s) 175
Eco130I CCWWGG 1 cut(s) 178
EcoT14I CCWWGG 1 cut(s) 178
ErhI CCWWGG 1 cut(s) 178
FaeI CATG 2 cut(s) 73, 182
FaiI YATR 4 cut(s) 71, 180, 299, 309
FaqI GGGAC 1 cut(s) 44
FatI CATG 2 cut(s) 69, 178
FokI GGATG 1 cut(s) 17
FspBI CTAG 1 cut(s) 285
GlaI GCGC 1 cut(s) 303
HaeII RGCGCY 1 cut(s) 305
HaeIII GGCC 2 cut(s) 129, 177
HapII CCGG 1 cut(s) 62
HhaI GCGC 1 cut(s) 304
Hin1II CATG 2 cut(s) 73, 182
Hin6I GCGC 1 cut(s) 302
HinP1I GCGC 1 cut(s) 302
HpaII CCGG 1 cut(s) 62
HphI GGTGA 1 cut(s) 43
Hpy188I TCNGA 1 cut(s) 261
HpyAV CCTTC 1 cut(s) 68
HpyCH4III ACNGT 3 cut(s) 58, 202, 217
HpyCH4IV ACGT 1 cut(s) 110
HpyF3I CTNAG 1 cut(s) 163
HpySE526I ACGT 1 cut(s) 110
Hsp92II CATG 2 cut(s) 73, 182
HspAI GCGC 1 cut(s) 302
Kzo9I GATC 1 cut(s) 166
LpnPI CCDG 1 cut(s) 75
MaeI CTAG 1 cut(s) 285
MaeII ACGT 1 cut(s) 110
MaeIII GTNAC 3 cut(s) 15, 106, 153
MalI GATC 1 cut(s) 168
MboI GATC 1 cut(s) 166
MfeI CAATTG 1 cut(s) 247
MluCI AATT 4 cut(s) 145, 192, 247, 279
MmeI TCCRAC 1 cut(s) 201
MnlI CCTC 2 cut(s) 40, 50
MseI TTAA 3 cut(s) 143, 204, 237
MspI CCGG 1 cut(s) 62
MspR9I CCNGG 1 cut(s) 62
MunI CAATTG 1 cut(s) 247
NciI CCSGG 1 cut(s) 62
NcoI CCATGG 1 cut(s) 178
NdeII GATC 1 cut(s) 166
NlaIII CATG 2 cut(s) 73, 182
NmuCI GTSAC 1 cut(s) 15
Psp1406I AACGTT 1 cut(s) 110
RsaI GTAC 2 cut(s) 187, 267
RsaNI GTAC 2 cut(s) 186, 266
SaqAI TTAA 3 cut(s) 143, 204, 237
Sau3AI GATC 1 cut(s) 166
ScaI AGTACT 1 cut(s) 267
ScrFI CCNGG 1 cut(s) 62
SetI ASST 3 cut(s) 32, 113, 230
SgeI CNNG 9 cut(s) 25, 73, 74, 82, 91, 170, 191, 226, 297
Sse9I AATT 4 cut(s) 145, 192, 247, 279
SspI AATATT 1 cut(s) 95
SspMI CTAG 1 cut(s) 285
StyD4I CCNGG 1 cut(s) 60
StyI CCWWGG 1 cut(s) 178
TaaI ACNGT 3 cut(s) 58, 202, 217
TaiI ACGT 1 cut(s) 113
TasI AATT 4 cut(s) 145, 192, 247, 279
TatI WGTACW 1 cut(s) 265
Tru1I TTAA 3 cut(s) 143, 204, 237
Tru9I TTAA 3 cut(s) 143, 204, 237
TscAI CASTG 1 cut(s) 205
TseFI GTSAC 1 cut(s) 15
Tsp45I GTSAC 1 cut(s) 15
TspDTI ATGAA 2 cut(s) 88, 137
TspRI CASTG 1 cut(s) 205
XapI RAATTY 1 cut(s) 145
XspI CTAG 1 cut(s) 285
ZrmI AGTACT 1 cut(s) 267
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.