MD16G1185000.v1.1

Belongs to the peptidase A1 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr16
OG0000716
Physical Location & Seq
Forward (+)
15936637 .. 15936864
228 bp
Loading structure...
UTR
Exon/CDS
Intron
MD16G1185000.v1.1.491

Sequence Viewer

Length: 228 bp
ATGTTCGGAGTAAATTCAATGGTGCGGGTGAGCAGTGATGTCTTATGTTTAGGGTTTGTGGATGGAGGTGAGAGGCTAAGTATTTCTAATGTGATTGAAGGGTACCAATTGGAAGACAATCTTCTGCAGTTTGATCTGGCTACTTCTAGGCTTGAGTTTAGCTCATCACTTTTGTTCAAAAGAACAACTTGTGGAACTTCAACTTCACTTCTAATGCTCAAGTGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
TAXi_C TAXi_N

Protein Analysis

76

Amino Acids

8.25

Weight (kDa)

4.77

Isoelectric Point (pI)

33.7

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TAXi_C PF14541 2 - 54 3e-16 Xylanase inhibitor C-terminal
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 102
AccB1I GGYRCC 1 cut(s) 102
AciI CCGC 1 cut(s) 25
AcsI RAATTY 1 cut(s) 13
AfaI GTAC 1 cut(s) 104
AgsI TTSAA 4 cut(s) 18, 98, 178, 201
AluBI AGCT 1 cut(s) 162
AluI AGCT 1 cut(s) 162
ApoI RAATTY 1 cut(s) 13
Asp718I GGTACC 1 cut(s) 102
AsuHPI GGTGA 2 cut(s) 40, 80
BanI GGYRCC 1 cut(s) 102
BbsI GAAGAC 1 cut(s) 120
BccI CCATC 1 cut(s) 56
BfaI CTAG 1 cut(s) 147
BfmI CTRYAG 1 cut(s) 125
BmiI GGNNCC 1 cut(s) 104
BpiI GAAGAC 1 cut(s) 120
BplI GAGNNNNNCTC 2 cut(s) 146, 178
BpuEI CTTGAG 2 cut(s) 173, 203
BseGI GGATG 1 cut(s) 67
BshNI GGYRCC 1 cut(s) 102
Bsp143I GATC 1 cut(s) 133
BspACI CCGC 1 cut(s) 25
BspLI GGNNCC 1 cut(s) 104
BspMAI CTGCAG 1 cut(s) 129
BspT107I GGYRCC 1 cut(s) 102
BssMI GATC 1 cut(s) 133
BstDEI CTNAG 1 cut(s) 77
BstF5I GGATG 1 cut(s) 67
BstKTI GATC 1 cut(s) 136
BstMBI GATC 1 cut(s) 133
BstSFI CTRYAG 1 cut(s) 125
BstV2I GAAGAC 1 cut(s) 120
BtsCI GGATG 1 cut(s) 67
BtsI GCAGTG 1 cut(s) 40
BtsIMutI CAGTG 1 cut(s) 40
Csp6I GTAC 1 cut(s) 103
CviJI RGCY 4 cut(s) 76, 140, 151, 162
CviKI_1 RGCY 4 cut(s) 76, 140, 151, 162
CviQI GTAC 1 cut(s) 103
DdeI CTNAG 1 cut(s) 77
DpnI GATC 1 cut(s) 135
DpnII GATC 1 cut(s) 133
FaiI YATR 1 cut(s) 46
FalI AAGNNNNNCTT 4 cut(s) 105, 137, 172, 204
FauI CCCGC 1 cut(s) 18
FokI GGATG 1 cut(s) 74
FspBI CTAG 1 cut(s) 147
HphI GGTGA 2 cut(s) 40, 80
Hpy188I TCNGA 1 cut(s) 8
HpyAV CCTTC 1 cut(s) 92
HpyCH4V TGCA 1 cut(s) 127
HpyF3I CTNAG 1 cut(s) 77
KpnI GGTACC 1 cut(s) 106
Kzo9I GATC 1 cut(s) 133
LpnPI CCDG 1 cut(s) 122
MaeI CTAG 1 cut(s) 147
MalI GATC 1 cut(s) 135
MboI GATC 1 cut(s) 133
MboII GAAGA 2 cut(s) 113, 125
MfeI CAATTG 1 cut(s) 107
MluCI AATT 2 cut(s) 13, 107
MnlI CCTC 2 cut(s) 59, 66
MunI CAATTG 1 cut(s) 107
NdeII GATC 1 cut(s) 133
NlaIV GGNNCC 1 cut(s) 104
PspN4I GGNNCC 1 cut(s) 104
PstI CTGCAG 1 cut(s) 129
RsaI GTAC 1 cut(s) 104
RsaNI GTAC 1 cut(s) 103
Sau3AI GATC 1 cut(s) 133
SetI ASST 2 cut(s) 70, 164
SfcI CTRYAG 1 cut(s) 125
SgeI CNNG 5 cut(s) 38, 149, 159, 164, 201
SmlI CTYRAG 2 cut(s) 152, 218
SmoI CTYRAG 2 cut(s) 152, 218
Sse9I AATT 2 cut(s) 13, 107
SsiI CCGC 1 cut(s) 25
SspMI CTAG 1 cut(s) 147
TasI AATT 2 cut(s) 13, 107
TscAI CASTG 1 cut(s) 40
TspRI CASTG 1 cut(s) 40
XapI RAATTY 1 cut(s) 13
XspI CTAG 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.