Prupe.4G287300_v2.0.a1

No apical meristem-associated C-terminal domain

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
Physical Location & Seq
Forward (+)
25181002 .. 25181915
914 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G287300.1

Sequence Viewer

Length: 732 bp
ATGGCCGAAAGTTCAAAGCAAAAAGGTGCAAATTACTCCATCGATGAAGATGTTGCTCTATGCCGAGCTTGGATAATCATTAGTGAAGATCCAATTATCAGAAATTGTCAATCAATCATACAATTTCATCTCGATGCCCAAGAAGTTAGATCATCAAAGAGCTTGAAATCGCTTTGGATTAACATCTCCCAAATGTGCAACAAATTCTCCGAGTGTCTTACTCAAGTGGAAAGGTTGAACAAGAGTGGCCAAAATGAAAATGACAATAGGACCAAGAAAGTATTCCTCATTGACCACTGTTGGAATGTTGTTCAACATGCTCATAAGTGGCAACCCTTTGAAGGGTTTCAATCCTCCCCTTTTATGATGATTCACCGTATGAATCCATTCCAGAAACTCAAGCACCCCCACAAACCTCAAACCCATGGCGAAGGCCTATGGGACACAAAAAAAGCTAAGGAGCTAAAAAGAAAGGCTATTGTGGAAGAGTCATCTCAAGATGATAAAGAGATGAAGGAAATTATGAGGTCTTACAAAGATTGTATGATTGAGAACAAAGAGTTGAAGGTTATGTTTAAGGAAACCGCCACAATCCAAACTCCGGCAATAAGGCGATGGGTCCAACAGAAACAAGCTGATATTATCGCAAAGAGTTCTTCCCGTTCGTTAACTTTGAGGATGAAGTCTATCGTCCCCAACCCCCAGAAGATGATGATTTCTAGAATAGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

244

Amino Acids

28.43

Weight (kDa)

9.46

Isoelectric Point (pI)

61.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 585
AclWI GGATC 1 cut(s) 83
AcoI YGGCCR 2 cut(s) 3, 247
AcsI RAATTY 1 cut(s) 203
AfiI CCNNNNNNNGG 3 cut(s) 341, 342, 601
AgsI TTSAA 7 cut(s) 15, 166, 238, 314, 341, 350, 565
AjuI GAANNNNNNNTTGG 2 cut(s) 266, 298
AluBI AGCT 5 cut(s) 68, 162, 455, 463, 635
AluI AGCT 5 cut(s) 68, 162, 455, 463, 635
AlwI GGATC 1 cut(s) 83
AoxI GGCC 3 cut(s) 3, 247, 433
ApoI RAATTY 1 cut(s) 203
Asp700I GAANNNNTTC 3 cut(s) 281, 345, 386
AspS9I GGNCC 2 cut(s) 270, 619
AsuHPI GGTGA 1 cut(s) 365
AvaII GGWCC 2 cut(s) 270, 619
BalI TGGCCA 1 cut(s) 249
BccI CCATC 2 cut(s) 47, 609
BfaI CTAG 1 cut(s) 720
Bme18I GGWCC 2 cut(s) 270, 619
BmgT120I GGNCC 2 cut(s) 270, 619
BmiI GGNNCC 1 cut(s) 620
BmsI GCATC 1 cut(s) 124
Bpu10I CCTNAGC 1 cut(s) 456
BpuEI CTTGAG 3 cut(s) 207, 383, 480
Bsa29I ATCGAT 1 cut(s) 42
BsaBI GATNNNNATC 1 cut(s) 182
BsaJI CCNNGG 1 cut(s) 424
BsaXI ACNNNNNCTCC 2 cut(s) 191, 221
Bsc4I CCNNNNNNNGG 3 cut(s) 341, 342, 601
Bse8I GATNNNNATC 1 cut(s) 182
BseCI ATCGAT 1 cut(s) 42
BseDI CCNNGG 1 cut(s) 424
BseGI GGATG 1 cut(s) 684
BseJI GATNNNNATC 1 cut(s) 182
BseLI CCNNNNNNNGG 3 cut(s) 341, 342, 601
BshFI GGCC 3 cut(s) 5, 249, 435
BshVI ATCGAT 1 cut(s) 42
BsiSI CCGG 1 cut(s) 602
BslFI GGGAC 2 cut(s) 455, 677
BslI CCNNNNNNNGG 3 cut(s) 341, 342, 601
BsmFI GGGAC 2 cut(s) 455, 677
BsnI GGCC 3 cut(s) 5, 249, 435
Bsp143I GATC 2 cut(s) 88, 149
Bsp19I CCATGG 1 cut(s) 424
BspACI CCGC 1 cut(s) 585
BspANI GGCC 3 cut(s) 5, 249, 435
BspDI ATCGAT 1 cut(s) 42
BspLI GGNNCC 1 cut(s) 620
BspPI GGATC 1 cut(s) 83
BssECI CCNNGG 1 cut(s) 424
BssMI GATC 2 cut(s) 88, 149
BssT1I CCWWGG 1 cut(s) 424
Bst4CI ACNGT 2 cut(s) 299, 377
Bst6I CTCTTC 1 cut(s) 480
BstDEI CTNAG 1 cut(s) 456
BstDSI CCRYGG 1 cut(s) 424
BstF5I GGATG 1 cut(s) 684
BstKTI GATC 2 cut(s) 91, 152
BstMBI GATC 2 cut(s) 88, 149
BstNSI RCATGY 1 cut(s) 320
BstX2I RGATCY 1 cut(s) 88
BstYI RGATCY 1 cut(s) 88
Bsu15I ATCGAT 1 cut(s) 42
BsuRI GGCC 3 cut(s) 5, 249, 435
BsuTUI ATCGAT 1 cut(s) 42
BtgI CCRYGG 1 cut(s) 424
BtgZI GCGATG 1 cut(s) 628
BtsCI GGATG 1 cut(s) 684
BtsIMutI CAGTG 1 cut(s) 295
Cfr13I GGNCC 2 cut(s) 270, 619
ClaI ATCGAT 1 cut(s) 42
CviAII CATG 2 cut(s) 317, 425
CviJI RGCY 9 cut(s) 5, 68, 162, 249, 435, 455, 463, 476, 635
CviKI_1 RGCY 9 cut(s) 5, 68, 162, 249, 435, 455, 463, 476, 635
DdeI CTNAG 1 cut(s) 456
DpnI GATC 2 cut(s) 90, 151
DpnII GATC 2 cut(s) 88, 149
EaeI YGGCCR 2 cut(s) 3, 247
Eam1104I CTCTTC 1 cut(s) 480
EarI CTCTTC 1 cut(s) 480
Eco130I CCWWGG 1 cut(s) 424
Eco147I AGGCCT 1 cut(s) 435
Eco47I GGWCC 2 cut(s) 270, 619
EcoT14I CCWWGG 1 cut(s) 424
ErhI CCWWGG 1 cut(s) 424
FaeI CATG 2 cut(s) 320, 428
FaqI GGGAC 2 cut(s) 455, 677
FatI CATG 2 cut(s) 316, 424
FokI GGATG 1 cut(s) 691
FspBI CTAG 1 cut(s) 720
HaeIII GGCC 3 cut(s) 5, 249, 435
HapII CCGG 1 cut(s) 602
Hin1II CATG 2 cut(s) 320, 428
HincII GTYRAC 1 cut(s) 669
HindII GTYRAC 1 cut(s) 669
HinfI GANTC 3 cut(s) 370, 382, 488
HpaI GTTAAC 1 cut(s) 669
HpaII CCGG 1 cut(s) 602
HphI GGTGA 1 cut(s) 365
Hpy166II GTNNAC 1 cut(s) 669
Hpy188I TCNGA 2 cut(s) 101, 211
Hpy188III TCNNGA 4 cut(s) 131, 391, 497, 720
Hpy8I GTNNAC 1 cut(s) 669
HpyAV CCTTC 4 cut(s) 335, 425, 508, 559
HpyCH4III ACNGT 2 cut(s) 299, 377
HpyCH4V TGCA 2 cut(s) 29, 198
HpyF3I CTNAG 1 cut(s) 456
Hsp92II CATG 2 cut(s) 320, 428
KspAI GTTAAC 1 cut(s) 669
Kzo9I GATC 2 cut(s) 88, 149
LmnI GCTCC 1 cut(s) 460
LpnPI CCDG 3 cut(s) 404, 615, 716
LweI GCATC 1 cut(s) 124
MaeI CTAG 1 cut(s) 720
MalI GATC 2 cut(s) 90, 151
MboI GATC 2 cut(s) 88, 149
MboII GAAGA 5 cut(s) 59, 98, 497, 648, 718
MflI RGATCY 1 cut(s) 88
MlsI TGGCCA 1 cut(s) 249
MluCI AATT 6 cut(s) 31, 93, 103, 122, 203, 519
MluNI TGGCCA 1 cut(s) 249
MlyI GAGTC 1 cut(s) 497
MmeI TCCRAC 2 cut(s) 281, 646
MnlI CCTC 5 cut(s) 296, 364, 426, 519, 669
Mox20I TGGCCA 1 cut(s) 249
MroXI GAANNNNTTC 3 cut(s) 281, 345, 386
MscI TGGCCA 1 cut(s) 249
MseI TTAA 4 cut(s) 180, 576, 668, 730
MslI CAYNNNNRTG 1 cut(s) 132
Msp20I TGGCCA 1 cut(s) 249
MspI CCGG 1 cut(s) 602
NcoI CCATGG 1 cut(s) 424
NdeII GATC 2 cut(s) 88, 149
NlaIII CATG 2 cut(s) 320, 428
NlaIV GGNNCC 1 cut(s) 620
NmeAIII GCCGAG 1 cut(s) 89
NspI RCATGY 1 cut(s) 320
PceI AGGCCT 1 cut(s) 435
PdmI GAANNNNTTC 3 cut(s) 281, 345, 386
PfeI GAWTC 2 cut(s) 370, 382
PleI GAGTC 1 cut(s) 496
PpsI GAGTC 1 cut(s) 496
PspN4I GGNNCC 1 cut(s) 620
PspPI GGNCC 2 cut(s) 270, 619
PsuI RGATCY 1 cut(s) 88
RseI CAYNNNNRTG 1 cut(s) 132
SaqAI TTAA 4 cut(s) 180, 576, 668, 730
Sau3AI GATC 2 cut(s) 88, 149
Sau96I GGNCC 2 cut(s) 270, 619
SchI GAGTC 1 cut(s) 497
SfaNI GCATC 1 cut(s) 124
SinI GGWCC 2 cut(s) 270, 619
SmiMI CAYNNNNRTG 1 cut(s) 132
SmlI CTYRAG 3 cut(s) 222, 398, 495
SmoI CTYRAG 3 cut(s) 222, 398, 495
Sse9I AATT 6 cut(s) 31, 93, 103, 122, 203, 519
SseBI AGGCCT 1 cut(s) 435
SsiI CCGC 1 cut(s) 585
SspMI CTAG 1 cut(s) 720
StuI AGGCCT 1 cut(s) 435
StyI CCWWGG 1 cut(s) 424
TaaI ACNGT 2 cut(s) 299, 377
TaqI TCGA 2 cut(s) 42, 132
TasI AATT 6 cut(s) 31, 93, 103, 122, 203, 519
TfiI GAWTC 2 cut(s) 370, 382
Tru1I TTAA 4 cut(s) 180, 576, 668, 730
Tru9I TTAA 4 cut(s) 180, 576, 668, 730
TscAI CASTG 1 cut(s) 302
TspDTI ATGAA 6 cut(s) 60, 116, 270, 395, 527, 695
TspRI CASTG 1 cut(s) 302
VpaK11BI GGWCC 2 cut(s) 270, 619
XapI RAATTY 1 cut(s) 203
XbaI TCTAGA 1 cut(s) 719
XceI RCATGY 1 cut(s) 320
XmnI GAANNNNTTC 3 cut(s) 281, 345, 386
XspI CTAG 1 cut(s) 720
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.