Rh4CG123400

No apical meristem-associated C-terminal domain

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Forward (+)
23776772 .. 23777719
948 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG123400.1

Sequence Viewer

Length: 198 bp
ATGGATCTAATGTTTGGAAAGAAAAGGTTGTTCTGGTATGAGGAGGATGGTGTTGACAAGAATGTGTTACTATTGTTGATGGCTTCGATGCCATTGAATTTCACTAACCTCCTCAACAATGAATCAGCCCTCGATGACCTCAATGAACCACATTTGACATACGATTTCCCGACGAGCCGTTGTAAACTAGCCGTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

65

Amino Acids

7.55

Weight (kDa)

4.6

Isoelectric Point (pI)

33.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 12
AcsI RAATTY 1 cut(s) 97
AgsI TTSAA 1 cut(s) 97
AlwI GGATC 1 cut(s) 12
ApoI RAATTY 1 cut(s) 97
BccI CCATC 2 cut(s) 41, 73
BceAI ACGGC 2 cut(s) 162, 176
BfaI CTAG 1 cut(s) 188
BmsI GCATC 1 cut(s) 78
BseGI GGATG 1 cut(s) 52
BseRI GAGGAG 2 cut(s) 56, 101
Bsp143I GATC 1 cut(s) 4
BspPI GGATC 1 cut(s) 12
BssMI GATC 1 cut(s) 4
BstF5I GGATG 1 cut(s) 52
BstKTI GATC 1 cut(s) 7
BstMBI GATC 1 cut(s) 4
BstX2I RGATCY 1 cut(s) 4
BstYI RGATCY 1 cut(s) 4
BtsCI GGATG 1 cut(s) 52
CviJI RGCY 4 cut(s) 83, 128, 177, 191
CviKI_1 RGCY 4 cut(s) 83, 128, 177, 191
DpnI GATC 1 cut(s) 6
DpnII GATC 1 cut(s) 4
FaiI YATR 3 cut(s) 39, 160, 196
FokI GGATG 1 cut(s) 59
FspBI CTAG 1 cut(s) 188
HincII GTYRAC 1 cut(s) 55
HindII GTYRAC 1 cut(s) 55
HinfI GANTC 1 cut(s) 122
Hpy166II GTNNAC 2 cut(s) 55, 185
Hpy188III TCNNGA 1 cut(s) 169
Hpy8I GTNNAC 2 cut(s) 55, 185
Hpy99I CGWCG 1 cut(s) 175
Kzo9I GATC 1 cut(s) 4
LpnPI CCDG 1 cut(s) 19
LweI GCATC 1 cut(s) 78
MaeI CTAG 1 cut(s) 188
MaeIII GTNAC 1 cut(s) 66
MalI GATC 1 cut(s) 6
MboI GATC 1 cut(s) 4
MflI RGATCY 1 cut(s) 4
MluCI AATT 1 cut(s) 97
MnlI CCTC 6 cut(s) 34, 37, 119, 122, 140, 149
NdeII GATC 1 cut(s) 4
PfeI GAWTC 1 cut(s) 122
PsuI RGATCY 1 cut(s) 4
Sau3AI GATC 1 cut(s) 4
SetI ASST 3 cut(s) 29, 111, 141
SfaNI GCATC 1 cut(s) 78
SgeI CNNG 5 cut(s) 46, 70, 143, 181, 186
Sse9I AATT 1 cut(s) 97
SspMI CTAG 1 cut(s) 188
TaqI TCGA 2 cut(s) 86, 132
TasI AATT 1 cut(s) 97
TfiI GAWTC 1 cut(s) 122
TspDTI ATGAA 2 cut(s) 135, 159
XapI RAATTY 1 cut(s) 97
XspI CTAG 1 cut(s) 188
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.