RLG00000029894

No apical meristem-associated C-terminal domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr6
OG0001050
Physical Location & Seq
Forward (+)
50949506 .. 50950253
748 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000029894

Sequence Viewer

Length: 603 bp
ATGTATACCACTACCTTTTCTAATATGAGCATAGTGAAGGCAAAAGAGATGTTCAAGAAAAAGGAAGGTCATACATTTGTACTTGACCATTGTTGGGCTATTATGAGGTTCCAGCAAAAATGGATGGATGAACATAAAAAAATCAATGCCAAGAGAAAGTTCAAGGCTCCTGATTCAATCAATTTAGAAGATGATGATGTAGAAGGTCCTGAACCTGCACCCTTGAAGAGGCCAATTGGGAGAAAAGCTGCAAAGGAAGTGGTCAAAAAGGCAAAATCCAGCGAACAGGTTAGTAAAAATGAGACACCTTCGAAAAGTACTTCTGAGTTGGAAGAGTTTATGGCAAAAAAATTAGAAAGTGAACGCATAAGGGCGGAACAATTTAAGTTGCTACTTGCTACTGAGCAAAAGCAAGTTGCTCTTAGAGAAAAGGAAATTGAAATTCAGCTTCAAAGTGAGGATGCTAAAATAATGGCCATGGATGCTAGTGTCATGCCTCCAATTCAAGCAGAATACTTTATCGGTCTTCAGAAGGAAATATTGGCAAAAAGAACTAGCAGCGGTGGAAATCAAGTGTTTCTTTCTGAATGTACAATAAGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NAM-associated

Protein Analysis

201

Amino Acids

22.95

Weight (kDa)

9.05

Isoelectric Point (pI)

59.1

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NAM-associated PF14303 25 - 180 1.2e-14 No apical meristem-associated C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 223
AccI GTMKAC 1 cut(s) 5
AciI CCGC 2 cut(s) 374, 561
AcoI YGGCCR 1 cut(s) 474
AcsI RAATTY 1 cut(s) 441
AcuI CTGAAG 1 cut(s) 512
AfaI GTAC 3 cut(s) 81, 319, 592
AfiI CCNNNNNNNGG 2 cut(s) 94, 228
AgsI TTSAA 7 cut(s) 55, 163, 177, 226, 440, 452, 506
AjuI GAANNNNNNNTTGG 4 cut(s) 143, 175, 524, 556
AluBI AGCT 2 cut(s) 248, 448
AluI AGCT 2 cut(s) 248, 448
Alw26I GTCTC 1 cut(s) 296
AoxI GGCC 2 cut(s) 230, 474
ApeKI GCWGC 2 cut(s) 248, 558
ApoI RAATTY 1 cut(s) 441
AspS9I GGNCC 1 cut(s) 206
AsuII TTCGAA 1 cut(s) 311
AvaII GGWCC 1 cut(s) 206
BalI TGGCCA 1 cut(s) 476
BbsI GAAGAC 1 cut(s) 518
BbvI GCAGC 2 cut(s) 235, 570
BccI CCATC 1 cut(s) 118
BcoDI GTCTC 1 cut(s) 296
BfaI CTAG 2 cut(s) 486, 555
BfuAI ACCTGC 1 cut(s) 223
BisI GCNGC 2 cut(s) 249, 559
BlsI GCNGC 2 cut(s) 250, 560
BmcAI AGTACT 1 cut(s) 319
Bme18I GGWCC 1 cut(s) 206
BmgT120I GGNCC 1 cut(s) 206
BmiI GGNNCC 2 cut(s) 110, 168
BmsI GCATC 2 cut(s) 451, 472
BpiI GAAGAC 1 cut(s) 518
Bpu14I TTCGAA 1 cut(s) 311
BsaJI CCNNGG 1 cut(s) 477
Bsc4I CCNNNNNNNGG 2 cut(s) 94, 228
BseDI CCNNGG 1 cut(s) 477
BseGI GGATG 4 cut(s) 129, 133, 466, 487
BseLI CCNNNNNNNGG 2 cut(s) 94, 228
BseMII CTCAG 2 cut(s) 315, 393
BseXI GCAGC 2 cut(s) 235, 570
BsgI GTGCAG 1 cut(s) 201
BshFI GGCC 2 cut(s) 232, 476
BslI CCNNNNNNNGG 2 cut(s) 94, 228
BsmAI GTCTC 1 cut(s) 296
BsnI GGCC 2 cut(s) 232, 476
Bsp119I TTCGAA 1 cut(s) 311
Bsp1407I TGTACA 1 cut(s) 590
Bsp19I CCATGG 1 cut(s) 477
BspACI CCGC 2 cut(s) 374, 561
BspANI GGCC 2 cut(s) 232, 476
BspCNI CTCAG 2 cut(s) 316, 394
BspLI GGNNCC 2 cut(s) 110, 168
BspMI ACCTGC 1 cut(s) 223
BspT104I TTCGAA 1 cut(s) 311
BsrGI TGTACA 1 cut(s) 590
BssECI CCNNGG 1 cut(s) 477
BssNAI GTATAC 1 cut(s) 6
BssT1I CCWWGG 1 cut(s) 477
Bst1107I GTATAC 1 cut(s) 6
Bst6I CTCTTC 2 cut(s) 221, 327
BstAUI TGTACA 1 cut(s) 590
BstBI TTCGAA 1 cut(s) 311
BstDEI CTNAG 3 cut(s) 324, 402, 422
BstDSI CCRYGG 1 cut(s) 477
BstENI CCTNNNNNAGG 1 cut(s) 226
BstF5I GGATG 4 cut(s) 129, 133, 466, 487
BstMAI GTCTC 1 cut(s) 296
BstMWI GCNNNNNNNGC 1 cut(s) 482
BstV1I GCAGC 2 cut(s) 235, 570
BstV2I GAAGAC 1 cut(s) 518
BstZ17I GTATAC 1 cut(s) 6
BsuRI GGCC 2 cut(s) 232, 476
BtgI CCRYGG 1 cut(s) 477
BtsCI GGATG 4 cut(s) 129, 133, 466, 487
BveI ACCTGC 1 cut(s) 223
Cfr13I GGNCC 1 cut(s) 206
Csp6I GTAC 3 cut(s) 80, 318, 591
CspCI CAANNNNNGTGG 2 cut(s) 240, 275
CviAII CATG 2 cut(s) 478, 493
CviJI RGCY 6 cut(s) 98, 167, 232, 248, 448, 476
CviKI_1 RGCY 6 cut(s) 98, 167, 232, 248, 448, 476
CviQI GTAC 3 cut(s) 80, 318, 591
DdeI CTNAG 3 cut(s) 324, 402, 422
EaeI YGGCCR 1 cut(s) 474
Eam1104I CTCTTC 2 cut(s) 221, 327
EarI CTCTTC 2 cut(s) 221, 327
EciI GGCGGA 1 cut(s) 389
Eco130I CCWWGG 1 cut(s) 477
Eco47I GGWCC 1 cut(s) 206
Eco57I CTGAAG 1 cut(s) 512
EcoNI CCTNNNNNAGG 1 cut(s) 226
EcoO109I RGGNCCY 1 cut(s) 206
EcoT14I CCWWGG 1 cut(s) 477
ErhI CCWWGG 1 cut(s) 477
FaeI CATG 2 cut(s) 481, 496
FalI AAGNNNNNCTT 4 cut(s) 405, 437, 564, 596
FatI CATG 2 cut(s) 477, 492
FblI GTMKAC 1 cut(s) 5
Fnu4HI GCNGC 2 cut(s) 249, 559
FokI GGATG 4 cut(s) 136, 140, 473, 494
Fsp4HI GCNGC 2 cut(s) 249, 559
FspBI CTAG 2 cut(s) 486, 555
GluI GCNGC 2 cut(s) 249, 559
HaeIII GGCC 2 cut(s) 232, 476
Hin1II CATG 2 cut(s) 481, 496
HinfI GANTC 1 cut(s) 173
Hpy166II GTNNAC 2 cut(s) 6, 362
Hpy188I TCNGA 3 cut(s) 325, 531, 586
Hpy188III TCNNGA 3 cut(s) 55, 170, 209
Hpy8I GTNNAC 2 cut(s) 6, 362
HpyAV CCTTC 5 cut(s) 31, 59, 197, 318, 526
HpyCH4V TGCA 2 cut(s) 218, 251
HpyF10VI GCNNNNNNNGC 1 cut(s) 482
HpyF3I CTNAG 3 cut(s) 324, 402, 422
Hsp92II CATG 2 cut(s) 481, 496
LmnI GCTCC 1 cut(s) 172
LpnPI CCDG 6 cut(s) 125, 183, 222, 228, 272, 292
Lsp1109I GCAGC 2 cut(s) 235, 570
LweI GCATC 2 cut(s) 451, 472
MaeI CTAG 2 cut(s) 486, 555
MboII GAAGA 4 cut(s) 200, 238, 344, 518
MfeI CAATTG 1 cut(s) 234
MlsI TGGCCA 1 cut(s) 476
MluCI AATT 7 cut(s) 181, 234, 350, 380, 435, 441, 501
MluNI TGGCCA 1 cut(s) 476
MmeI TCCRAC 1 cut(s) 309
MnlI CCTC 4 cut(s) 99, 222, 451, 507
Mox20I TGGCCA 1 cut(s) 476
MscI TGGCCA 1 cut(s) 476
MseI TTAA 1 cut(s) 384
Msp20I TGGCCA 1 cut(s) 476
MspA1I CMGCKG 1 cut(s) 561
MunI CAATTG 1 cut(s) 234
MwoI GCNNNNNNNGC 1 cut(s) 482
NcoI CCATGG 1 cut(s) 477
NlaIII CATG 2 cut(s) 481, 496
NlaIV GGNNCC 2 cut(s) 110, 168
NspV TTCGAA 1 cut(s) 311
PfeI GAWTC 1 cut(s) 173
PkrI GCNGC 2 cut(s) 250, 560
PpuMI RGGWCCY 1 cut(s) 206
Psp5II RGGWCCY 1 cut(s) 206
PspN4I GGNNCC 2 cut(s) 110, 168
PspPI GGNCC 1 cut(s) 206
PspPPI RGGWCCY 1 cut(s) 206
RsaI GTAC 3 cut(s) 81, 319, 592
RsaNI GTAC 3 cut(s) 80, 318, 591
SaqAI TTAA 1 cut(s) 384
SatI GCNGC 2 cut(s) 249, 559
Sau96I GGNCC 1 cut(s) 206
ScaI AGTACT 1 cut(s) 319
SetI ASST 9 cut(s) 17, 70, 110, 208, 217, 250, 291, 310, 450
SfaNI GCATC 2 cut(s) 451, 472
SfuI TTCGAA 1 cut(s) 311
SinI GGWCC 1 cut(s) 206
Sse9I AATT 7 cut(s) 181, 234, 350, 380, 435, 441, 501
SsiI CCGC 2 cut(s) 374, 561
SspI AATATT 1 cut(s) 540
SspMI CTAG 2 cut(s) 486, 555
StyI CCWWGG 1 cut(s) 477
TaqI TCGA 1 cut(s) 311
TaqII GACCGA 1 cut(s) 512
TasI AATT 7 cut(s) 181, 234, 350, 380, 435, 441, 501
TatI WGTACW 3 cut(s) 79, 317, 590
TfiI GAWTC 1 cut(s) 173
Tru1I TTAA 1 cut(s) 384
Tru9I TTAA 1 cut(s) 384
TseI GCWGC 2 cut(s) 248, 558
TspDTI ATGAA 1 cut(s) 144
VpaK11BI GGWCC 1 cut(s) 206
XagI CCTNNNNNAGG 1 cut(s) 226
XapI RAATTY 1 cut(s) 441
XmiI GTMKAC 1 cut(s) 5
XspI CTAG 2 cut(s) 486, 555
ZrmI AGTACT 1 cut(s) 319
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.