Rh6DG128500

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
OG0001050
Physical Location & Seq
Forward (+)
18127653 .. 18129137
1485 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG128500.1

Sequence Viewer

Length: 198 bp
ATGGATTCATCCCAAATATCATCATCCTCTCTTTCTTCAAATGGAACCATTGAGTATTGCAATTCTGTCTTGGCCGCATTTGATCGGGAGCAAGATTTATTACTTCGTATGTGTGCTAACAACAATCTCCTCTTAGCAGAAAATCTCGACGACGAAGAAGATGATGCTCATTCATGCCAGAGAGTTCAAGAAAGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

7.2

Weight (kDa)

4.05

Isoelectric Point (pI)

59.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 75
AcoI YGGCCR 1 cut(s) 72
AgsI TTSAA 2 cut(s) 39, 188
AluBI AGCT 1 cut(s) 195
AluI AGCT 1 cut(s) 195
AoxI GGCC 1 cut(s) 72
BisI GCNGC 1 cut(s) 75
BlsI GCNGC 1 cut(s) 76
BmiI GGNNCC 1 cut(s) 46
BmsI GCATC 1 cut(s) 154
BseGI GGATG 2 cut(s) 8, 23
BseRI GAGGAG 1 cut(s) 119
BshFI GGCC 1 cut(s) 74
BsnI GGCC 1 cut(s) 74
Bsp143I GATC 1 cut(s) 82
BspACI CCGC 1 cut(s) 75
BspANI GGCC 1 cut(s) 74
BspLI GGNNCC 1 cut(s) 46
BssMI GATC 1 cut(s) 82
BstDEI CTNAG 1 cut(s) 133
BstF5I GGATG 2 cut(s) 8, 23
BstKTI GATC 1 cut(s) 85
BstMBI GATC 1 cut(s) 82
BsuRI GGCC 1 cut(s) 74
BtsCI GGATG 2 cut(s) 8, 23
CviAII CATG 1 cut(s) 174
CviJI RGCY 2 cut(s) 74, 195
CviKI_1 RGCY 2 cut(s) 74, 195
DdeI CTNAG 1 cut(s) 133
DpnI GATC 1 cut(s) 84
DpnII GATC 1 cut(s) 82
EaeI YGGCCR 1 cut(s) 72
FaeI CATG 1 cut(s) 177
FaiI YATR 2 cut(s) 110, 175
FatI CATG 1 cut(s) 173
Fnu4HI GCNGC 1 cut(s) 75
FokI GGATG 1 cut(s) 10
Fsp4HI GCNGC 1 cut(s) 75
GluI GCNGC 1 cut(s) 75
HaeIII GGCC 1 cut(s) 74
Hin1II CATG 1 cut(s) 177
HinfI GANTC 1 cut(s) 5
Hpy188III TCNNGA 3 cut(s) 86, 146, 188
Hpy99I CGWCG 2 cut(s) 152, 155
HpyCH4V TGCA 1 cut(s) 60
HpyF3I CTNAG 1 cut(s) 133
Hsp92II CATG 1 cut(s) 177
Kzo9I GATC 1 cut(s) 82
LmnI GCTCC 1 cut(s) 88
LpnPI CCDG 1 cut(s) 191
LweI GCATC 1 cut(s) 154
MalI GATC 1 cut(s) 84
MboI GATC 1 cut(s) 82
MboII GAAGA 3 cut(s) 27, 167, 170
MluCI AATT 1 cut(s) 61
MnlI CCTC 2 cut(s) 37, 140
NdeII GATC 1 cut(s) 82
NlaIII CATG 1 cut(s) 177
NlaIV GGNNCC 1 cut(s) 46
PfeI GAWTC 1 cut(s) 5
PkrI GCNGC 1 cut(s) 76
PspN4I GGNNCC 1 cut(s) 46
SatI GCNGC 1 cut(s) 75
Sau3AI GATC 1 cut(s) 82
SetI ASST 1 cut(s) 197
SfaNI GCATC 1 cut(s) 154
SgeI CNNG 6 cut(s) 82, 98, 104, 158, 186, 190
Sse9I AATT 1 cut(s) 61
SsiI CCGC 1 cut(s) 75
TaqI TCGA 1 cut(s) 147
TasI AATT 1 cut(s) 61
TauI GCSGC 1 cut(s) 77
TfiI GAWTC 1 cut(s) 5
TspDTI ATGAA 1 cut(s) 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.