Rh2DG368700

No apical meristem-associated C-terminal domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
OG0001050
Physical Location & Seq
Forward (+)
52185368 .. 52189109
3742 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG368700.1

Sequence Viewer

Length: 237 bp
ATGGTCCAGGACGAAGCACCCAGTGCAAGCAGGACTAAGCACCCAGTGCAAGCAGGACTAAGCACCCAGTGCAAGCATGTTCCAGATGATGCTCAACCAAGAAAGAAGACGGTAGTGCAGATGGCTTCGACGCCATTGAATTTCACTAACCTCCTCAACAATGAATCAGCCTTCAATGACCTCAATGAACCACATTTGACATACGATTTCCCAGCGAGTCAGTCATTCACCTTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NAM-associated

Protein Analysis

78

Amino Acids

8.63

Weight (kDa)

5.79

Isoelectric Point (pI)

40.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 139
AcyI GRCGYC 1 cut(s) 131
AdeI CACNNNGTG 3 cut(s) 23, 46, 69
AgsI TTSAA 2 cut(s) 139, 175
AjnI CCWGG 1 cut(s) 6
ApoI RAATTY 1 cut(s) 139
AspS9I GGNCC 1 cut(s) 4
AsuHPI GGTGA 1 cut(s) 220
AvaII GGWCC 1 cut(s) 4
BbsI GAAGAC 1 cut(s) 113
BccI CCATC 1 cut(s) 115
BciT130I CCWGG 1 cut(s) 8
Bme1390I CCNGG 1 cut(s) 8
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 1 cut(s) 4
BmrFI CCNGG 1 cut(s) 8
BmrI ACTGGG 3 cut(s) 15, 38, 61
BmsI GCATC 1 cut(s) 79
BmuI ACTGGG 3 cut(s) 15, 38, 61
BpiI GAAGAC 1 cut(s) 113
BsaHI GRCGYC 1 cut(s) 131
Bse1I ACTGG 3 cut(s) 21, 44, 67
BseBI CCWGG 1 cut(s) 8
BseNI ACTGG 3 cut(s) 21, 44, 67
BseRI GAGGAG 1 cut(s) 143
BseYI CCCAGC 1 cut(s) 211
BsgI GTGCAG 1 cut(s) 137
BsrI ACTGG 3 cut(s) 21, 44, 67
BssNI GRCGYC 1 cut(s) 131
Bst2UI CCWGG 1 cut(s) 8
Bst4CI ACNGT 1 cut(s) 112
BstACI GRCGYC 1 cut(s) 131
BstAPI GCANNNNNTGC 3 cut(s) 23, 46, 69
BstC8I GCNNGC 3 cut(s) 28, 51, 74
BstDEI CTNAG 2 cut(s) 36, 59
BstMWI GCNNNNNNNGC 3 cut(s) 23, 46, 69
BstNI CCWGG 1 cut(s) 8
BstNSI RCATGY 1 cut(s) 80
BstSCI CCNGG 1 cut(s) 6
BstV2I GAAGAC 1 cut(s) 113
BtsIMutI CAGTG 3 cut(s) 28, 51, 74
Cac8I GCNNGC 3 cut(s) 28, 51, 74
Cfr13I GGNCC 1 cut(s) 4
CseI GACGC 1 cut(s) 139
CviAII CATG 1 cut(s) 77
CviJI RGCY 2 cut(s) 125, 170
CviKI_1 RGCY 2 cut(s) 125, 170
DdeI CTNAG 2 cut(s) 36, 59
DraIII CACNNNGTG 3 cut(s) 23, 46, 69
Eco47I GGWCC 1 cut(s) 4
EcoRII CCWGG 1 cut(s) 6
FaeI CATG 1 cut(s) 80
FaiI YATR 3 cut(s) 78, 202, 235
FatI CATG 1 cut(s) 76
GsaI CCCAGC 1 cut(s) 215
HgaI GACGC 1 cut(s) 139
Hin1I GRCGYC 1 cut(s) 131
Hin1II CATG 1 cut(s) 80
HinfI GANTC 2 cut(s) 164, 217
HphI GGTGA 1 cut(s) 220
Hpy188III TCNNGA 1 cut(s) 83
Hpy99I CGWCG 1 cut(s) 133
HpyAV CCTTC 1 cut(s) 181
HpyCH4III ACNGT 1 cut(s) 112
HpyCH4V TGCA 4 cut(s) 26, 49, 72, 118
HpyF10VI GCNNNNNNNGC 3 cut(s) 23, 46, 69
HpyF3I CTNAG 2 cut(s) 36, 59
Hsp92I GRCGYC 1 cut(s) 131
Hsp92II CATG 1 cut(s) 80
LpnPI CCDG 8 cut(s) 16, 20, 34, 39, 57, 80, 96, 225
LweI GCATC 1 cut(s) 79
MboII GAAGA 1 cut(s) 118
MluCI AATT 1 cut(s) 139
MlyI GAGTC 1 cut(s) 226
MnlI CCTC 3 cut(s) 161, 164, 191
MspR9I CCNGG 1 cut(s) 8
MvaI CCWGG 1 cut(s) 8
MwoI GCNNNNNNNGC 3 cut(s) 23, 46, 69
NlaIII CATG 1 cut(s) 80
NspI RCATGY 1 cut(s) 80
PfeI GAWTC 1 cut(s) 164
PfoI TCCNGGA 1 cut(s) 6
PleI GAGTC 1 cut(s) 225
PpsI GAGTC 1 cut(s) 225
Psp6I CCWGG 1 cut(s) 6
PspFI CCCAGC 1 cut(s) 211
PspGI CCWGG 1 cut(s) 6
PspPI GGNCC 1 cut(s) 4
Sau96I GGNCC 1 cut(s) 4
SchI GAGTC 1 cut(s) 226
ScrFI CCNGG 1 cut(s) 8
SetI ASST 3 cut(s) 153, 183, 233
SfaNI GCATC 1 cut(s) 79
SinI GGWCC 1 cut(s) 4
Sse9I AATT 1 cut(s) 139
StyD4I CCNGG 1 cut(s) 6
TaaI ACNGT 1 cut(s) 112
TaqI TCGA 1 cut(s) 128
TasI AATT 1 cut(s) 139
TfiI GAWTC 1 cut(s) 164
TscAI CASTG 3 cut(s) 28, 51, 74
TspDTI ATGAA 2 cut(s) 177, 201
TspRI CASTG 3 cut(s) 28, 51, 74
VpaK11BI GGWCC 1 cut(s) 4
XapI RAATTY 1 cut(s) 139
XceI RCATGY 1 cut(s) 80
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.