Rmu_sc0016357.1_g000001

Ribosomal protein-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0016357.1
OG0001050
Physical Location & Seq
Forward (+)
691 .. 996
306 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0016357.1_g000001.1.cds

Sequence Viewer

Length: 306 bp
atggattcatcccaaatatcatcatcctctctttcttcaaatggaaccgttgagtattgcatttctgtcttggccgcatttgatcgggagcaagatttgttacttcgtatgtgtgctaacaacaatctcctcttagcagaaaatctcgacgatgaagaagatgatgctcaatcatgtcggagaggtgcaattcctggtcatatagttgtttatcatgatcgagaagctgctgcacacaatttgtttacagattattttgcggaggtcccccgatttggtgagcaaaaatttcgcagacgtttttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Plant_tran

Protein Analysis

101

Amino Acids

11.46

Weight (kDa)

4.76

Isoelectric Point (pI)

61.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 75, 260
AcoI YGGCCR 1 cut(s) 72
AcsI RAATTY 1 cut(s) 287
AfiI CCNNNNNNNGG 1 cut(s) 275
AgsI TTSAA 1 cut(s) 39
AjnI CCWGG 1 cut(s) 193
AluBI AGCT 1 cut(s) 227
AluI AGCT 1 cut(s) 227
AoxI GGCC 1 cut(s) 72
ApeKI GCWGC 2 cut(s) 227, 230
ApoI RAATTY 1 cut(s) 287
AspS9I GGNCC 1 cut(s) 265
AsuHPI GGTGA 1 cut(s) 290
AvaII GGWCC 1 cut(s) 265
BbvI GCAGC 2 cut(s) 214, 217
BcgI CGANNNNNNTGC 2 cut(s) 272, 306
BciT130I CCWGG 1 cut(s) 195
BisI GCNGC 3 cut(s) 75, 228, 231
BlsI GCNGC 3 cut(s) 76, 229, 232
Bme1390I CCNGG 1 cut(s) 195
Bme18I GGWCC 1 cut(s) 265
BmgT120I GGNCC 1 cut(s) 265
BmiI GGNNCC 2 cut(s) 46, 267
BmrFI CCNGG 1 cut(s) 195
BmsI GCATC 1 cut(s) 154
Bsc4I CCNNNNNNNGG 1 cut(s) 275
BseBI CCWGG 1 cut(s) 195
BseGI GGATG 2 cut(s) 8, 23
BseLI CCNNNNNNNGG 1 cut(s) 275
BseRI GAGGAG 1 cut(s) 119
BseXI GCAGC 2 cut(s) 214, 217
BsgI GTGCAG 1 cut(s) 216
BshFI GGCC 1 cut(s) 74
BslFI GGGAC 1 cut(s) 251
BslI CCNNNNNNNGG 1 cut(s) 275
BsmFI GGGAC 1 cut(s) 251
BsnI GGCC 1 cut(s) 74
Bsp143I GATC 2 cut(s) 82, 217
BspACI CCGC 2 cut(s) 75, 260
BspANI GGCC 1 cut(s) 74
BspHI TCATGA 1 cut(s) 214
BspLI GGNNCC 2 cut(s) 46, 267
BssMI GATC 2 cut(s) 82, 217
Bst2UI CCWGG 1 cut(s) 195
Bst4CI ACNGT 1 cut(s) 49
BstDEI CTNAG 1 cut(s) 133
BstF5I GGATG 2 cut(s) 8, 23
BstKTI GATC 2 cut(s) 85, 220
BstMBI GATC 2 cut(s) 82, 217
BstNI CCWGG 1 cut(s) 195
BstSCI CCNGG 1 cut(s) 193
BstV1I GCAGC 2 cut(s) 214, 217
BsuRI GGCC 1 cut(s) 74
BtsCI GGATG 2 cut(s) 8, 23
CciI TCATGA 1 cut(s) 214
Cfr13I GGNCC 1 cut(s) 265
CviAII CATG 2 cut(s) 174, 215
CviJI RGCY 2 cut(s) 74, 227
CviKI_1 RGCY 2 cut(s) 74, 227
DdeI CTNAG 1 cut(s) 133
DpnI GATC 2 cut(s) 84, 219
DpnII GATC 2 cut(s) 82, 217
EaeI YGGCCR 1 cut(s) 72
Eco47I GGWCC 1 cut(s) 265
EcoO109I RGGNCCY 1 cut(s) 265
EcoRII CCWGG 1 cut(s) 193
FaeI CATG 2 cut(s) 177, 218
FaiI YATR 5 cut(s) 110, 175, 201, 203, 216
FaqI GGGAC 1 cut(s) 251
FatI CATG 2 cut(s) 173, 214
Fnu4HI GCNGC 3 cut(s) 75, 228, 231
FokI GGATG 1 cut(s) 10
Fsp4HI GCNGC 3 cut(s) 75, 228, 231
GluI GCNGC 3 cut(s) 75, 228, 231
HaeIII GGCC 1 cut(s) 74
Hin1II CATG 2 cut(s) 177, 218
HinfI GANTC 1 cut(s) 5
HphI GGTGA 1 cut(s) 290
Hpy166II GTNNAC 1 cut(s) 246
Hpy188I TCNGA 1 cut(s) 180
Hpy188III TCNNGA 4 cut(s) 86, 146, 215, 221
Hpy8I GTNNAC 1 cut(s) 246
Hpy99I CGWCG 1 cut(s) 152
HpyCH4III ACNGT 1 cut(s) 49
HpyCH4IV ACGT 1 cut(s) 298
HpyCH4V TGCA 3 cut(s) 60, 188, 233
HpyF3I CTNAG 1 cut(s) 133
HpySE526I ACGT 1 cut(s) 298
Hsp92II CATG 2 cut(s) 177, 218
Kzo9I GATC 2 cut(s) 82, 217
LmnI GCTCC 1 cut(s) 88
LpnPI CCDG 2 cut(s) 180, 207
Lsp1109I GCAGC 2 cut(s) 214, 217
LweI GCATC 1 cut(s) 154
MaeII ACGT 1 cut(s) 298
MaeIII GTNAC 1 cut(s) 99
MalI GATC 2 cut(s) 84, 219
MboI GATC 2 cut(s) 82, 217
MboII GAAGA 3 cut(s) 27, 167, 170
MluCI AATT 3 cut(s) 189, 238, 287
MmeI TCCRAC 1 cut(s) 158
MnlI CCTC 4 cut(s) 37, 140, 176, 256
MspR9I CCNGG 1 cut(s) 195
MvaI CCWGG 1 cut(s) 195
NdeII GATC 2 cut(s) 82, 217
NlaIII CATG 2 cut(s) 177, 218
NlaIV GGNNCC 2 cut(s) 46, 267
PagI TCATGA 1 cut(s) 214
PfeI GAWTC 1 cut(s) 5
PkrI GCNGC 3 cut(s) 76, 229, 232
PpuMI RGGWCCY 1 cut(s) 265
Psp5II RGGWCCY 1 cut(s) 265
Psp6I CCWGG 1 cut(s) 193
PspGI CCWGG 1 cut(s) 193
PspN4I GGNNCC 2 cut(s) 46, 267
PspPI GGNCC 1 cut(s) 265
PspPPI RGGWCCY 1 cut(s) 265
SatI GCNGC 3 cut(s) 75, 228, 231
Sau3AI GATC 2 cut(s) 82, 217
Sau96I GGNCC 1 cut(s) 265
ScrFI CCNGG 1 cut(s) 195
SetI ASST 4 cut(s) 187, 229, 267, 301
SfaNI GCATC 1 cut(s) 154
SinI GGWCC 1 cut(s) 265
Sse9I AATT 3 cut(s) 189, 238, 287
SsiI CCGC 2 cut(s) 75, 260
StyD4I CCNGG 1 cut(s) 193
TaaI ACNGT 1 cut(s) 49
TaiI ACGT 1 cut(s) 301
TaqI TCGA 2 cut(s) 147, 220
TasI AATT 3 cut(s) 189, 238, 287
TauI GCSGC 1 cut(s) 77
TfiI GAWTC 1 cut(s) 5
TseI GCWGC 2 cut(s) 227, 230
TspDTI ATGAA 1 cut(s) 168
VpaK11BI GGWCC 1 cut(s) 265
XapI RAATTY 1 cut(s) 287
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.