Rh7BG334100

DNA recombination

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Forward (+)
34671454 .. 34685231
13778 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG334100.1

Sequence Viewer

Length: 174 bp
ATGCCTTCAAGAGCCTGCAATGTACTTAGGGAAGCGGAGAGATCATTAGCCCAAATGTTCCTTCCATCAACCAATCCAGCAAAGAGGCAAATCAAAGACAAGACGGCTCATTTTGAACTTCGGGATGCATTGATTGATCATCTGTGGGATCGTCATGGCAGAGATGAAGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

57

Amino Acids

6.64

Weight (kDa)

8.0

Isoelectric Point (pI)

60.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 35
AclWI GGATC 1 cut(s) 156
AfaI GTAC 1 cut(s) 24
AgsI TTSAA 2 cut(s) 9, 116
AjuI GAANNNNNNNTTGG 2 cut(s) 45, 77
AluBI AGCT 1 cut(s) 170
AluI AGCT 1 cut(s) 170
AlwI GGATC 1 cut(s) 156
BccI CCATC 1 cut(s) 73
BceAI ACGGC 1 cut(s) 120
BclI TGATCA 1 cut(s) 136
BmsI GCATC 1 cut(s) 115
Bse3DI GCAATG 1 cut(s) 25
BseGI GGATG 1 cut(s) 130
BseMI GCAATG 1 cut(s) 25
Bsp143I GATC 3 cut(s) 41, 136, 148
BspACI CCGC 1 cut(s) 35
BspPI GGATC 1 cut(s) 156
BsrDI GCAATG 1 cut(s) 25
BssMI GATC 3 cut(s) 41, 136, 148
BstC8I GCNNGC 1 cut(s) 16
BstDEI CTNAG 1 cut(s) 26
BstF5I GGATG 1 cut(s) 130
BstKTI GATC 3 cut(s) 44, 139, 151
BstMBI GATC 3 cut(s) 41, 136, 148
BtsCI GGATG 1 cut(s) 130
Cac8I GCNNGC 1 cut(s) 16
Csp6I GTAC 1 cut(s) 23
CviAII CATG 1 cut(s) 155
CviJI RGCY 4 cut(s) 14, 50, 107, 170
CviKI_1 RGCY 4 cut(s) 14, 50, 107, 170
CviQI GTAC 1 cut(s) 23
DdeI CTNAG 1 cut(s) 26
DpnI GATC 3 cut(s) 43, 138, 150
DpnII GATC 3 cut(s) 41, 136, 148
EcoT22I ATGCAT 1 cut(s) 130
FaeI CATG 1 cut(s) 158
FaiI YATR 1 cut(s) 156
FatI CATG 1 cut(s) 154
FbaI TGATCA 1 cut(s) 136
FokI GGATG 1 cut(s) 137
Hin1II CATG 1 cut(s) 158
HindIII AAGCTT 1 cut(s) 168
Hpy188III TCNNGA 2 cut(s) 9, 122
HpyAV CCTTC 2 cut(s) 15, 71
HpyCH4V TGCA 2 cut(s) 18, 128
HpyF3I CTNAG 1 cut(s) 26
Hsp92II CATG 1 cut(s) 158
Ksp22I TGATCA 1 cut(s) 136
Kzo9I GATC 3 cut(s) 41, 136, 148
LpnPI CCDG 2 cut(s) 28, 90
LweI GCATC 1 cut(s) 115
MalI GATC 3 cut(s) 43, 138, 150
MboI GATC 3 cut(s) 41, 136, 148
MnlI CCTC 1 cut(s) 78
Mph1103I ATGCAT 1 cut(s) 130
NdeII GATC 3 cut(s) 41, 136, 148
NlaIII CATG 1 cut(s) 158
NsiI ATGCAT 1 cut(s) 130
RsaI GTAC 1 cut(s) 24
RsaNI GTAC 1 cut(s) 23
Sau3AI GATC 3 cut(s) 41, 136, 148
SetI ASST 1 cut(s) 172
SfaNI GCATC 1 cut(s) 115
SgeI CNNG 6 cut(s) 21, 27, 89, 112, 134, 167
SsiI CCGC 1 cut(s) 35
TatI WGTACW 1 cut(s) 22
Zsp2I ATGCAT 1 cut(s) 130
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.