Rmu_sc0000353.1_g000032

No apical meristem-associated C-terminal domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000353.1
OG0001050
Physical Location & Seq
Reverse (-)
137894 .. 138178
285 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000353.1_g000032.1.cds

Sequence Viewer

Length: 285 bp
atgagaataaatcttctaattaaaatccgttcggagttggaagagttgagggcaaggagattagaaagtgactacataaaggcagaacaatttaagttgttacttgctactgagcaaaggcaagttgctcttagagaaaaggaaattgaacttcaggctcgaagtgaggatgctaaaataatgtctatggatactagtgtcatgcctccatttcaagcagagtactttatcagtcttcaaaaggaaatcttggcaaaaagtggtagtaggaatgaaaatcaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NAM-associated

Protein Analysis

94

Amino Acids

11.06

Weight (kDa)

6.34

Isoelectric Point (pI)

72.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 137
AfaI GTAC 1 cut(s) 224
AgsI TTSAA 3 cut(s) 149, 215, 239
AhlI ACTAGT 1 cut(s) 194
BaeI ACNNNNGTAYC 2 cut(s) 183, 216
BbsI GAAGAC 1 cut(s) 227
BciVI GTATCC 1 cut(s) 184
BcuI ACTAGT 1 cut(s) 194
BfaI CTAG 1 cut(s) 195
BfuI GTATCC 1 cut(s) 184
BmcAI AGTACT 1 cut(s) 224
BmsI GCATC 1 cut(s) 160
BpiI GAAGAC 1 cut(s) 227
BseGI GGATG 1 cut(s) 175
BseMII CTCAG 1 cut(s) 102
BspCNI CTCAG 1 cut(s) 103
Bst6I CTCTTC 1 cut(s) 36
BstDEI CTNAG 2 cut(s) 111, 131
BstF5I GGATG 1 cut(s) 175
BstV2I GAAGAC 1 cut(s) 227
BsuI GTATCC 1 cut(s) 184
BtsCI GGATG 1 cut(s) 175
Csp6I GTAC 1 cut(s) 223
CviAII CATG 1 cut(s) 202
CviJI RGCY 1 cut(s) 158
CviKI_1 RGCY 1 cut(s) 158
CviQI GTAC 1 cut(s) 223
DdeI CTNAG 2 cut(s) 111, 131
Eam1104I CTCTTC 1 cut(s) 36
EarI CTCTTC 1 cut(s) 36
Eco57I CTGAAG 1 cut(s) 137
FaeI CATG 1 cut(s) 205
FaiI YATR 3 cut(s) 77, 188, 203
FalI AAGNNNNNCTT 4 cut(s) 114, 146, 233, 265
FatI CATG 1 cut(s) 201
FokI GGATG 1 cut(s) 182
FspBI CTAG 1 cut(s) 195
Hin1II CATG 1 cut(s) 205
Hpy188I TCNGA 1 cut(s) 34
HpyF3I CTNAG 2 cut(s) 111, 131
Hsp92II CATG 1 cut(s) 205
LpnPI CCDG 1 cut(s) 140
LweI GCATC 1 cut(s) 160
MaeI CTAG 1 cut(s) 195
MaeIII GTNAC 2 cut(s) 68, 99
MboII GAAGA 3 cut(s) 5, 53, 227
MluCI AATT 3 cut(s) 18, 89, 144
MmeI TCCRAC 1 cut(s) 18
MnlI CCTC 3 cut(s) 42, 160, 216
MseI TTAA 2 cut(s) 21, 93
NlaIII CATG 1 cut(s) 205
NmuCI GTSAC 1 cut(s) 68
RsaI GTAC 1 cut(s) 224
RsaNI GTAC 1 cut(s) 223
SaqAI TTAA 2 cut(s) 21, 93
ScaI AGTACT 1 cut(s) 224
SfaNI GCATC 1 cut(s) 160
SgeI CNNG 9 cut(s) 66, 116, 134, 167, 171, 207, 214, 227, 262
SpeI ACTAGT 1 cut(s) 194
Sse9I AATT 3 cut(s) 18, 89, 144
SspMI CTAG 1 cut(s) 195
TaqI TCGA 1 cut(s) 160
TasI AATT 3 cut(s) 18, 89, 144
TatI WGTACW 1 cut(s) 222
Tru1I TTAA 2 cut(s) 21, 93
Tru9I TTAA 2 cut(s) 21, 93
TseFI GTSAC 1 cut(s) 68
Tsp45I GTSAC 1 cut(s) 68
TspGWI ACGGA 1 cut(s) 17
XspI CTAG 1 cut(s) 195
ZrmI AGTACT 1 cut(s) 224
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.