Rh2CG424000

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
OG0001050
Physical Location & Seq
Reverse (-)
57800184 .. 57800469
286 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG424000.1

Sequence Viewer

Length: 228 bp
ATGGATCCATCCCAAATATCTTCATCCTCTCTGTCTTCAAATGGAACCATTGAGTGTTATAATTCTGTCTTGGCCGCATTTGATCGGGAGCAAGATTTGTTACTTCGTACGTATGCTAACAACAATCTCCTCTTGGCGGAACATCTCAACGACGAAGAGGACGATGCTCAATCACAAAGGAGAGGCGCAGTTCCTGGTCACATAAGGTCCCTCGATTTGGTGAGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

8.33

Weight (kDa)

4.54

Isoelectric Point (pI)

79.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 60
AciI CCGC 2 cut(s) 75, 137
AclWI GGATC 1 cut(s) 12
AcoI YGGCCR 1 cut(s) 72
AfaI GTAC 1 cut(s) 109
AfiI CCNNNNNNNGG 2 cut(s) 136, 217
AgsI TTSAA 1 cut(s) 39
AjnI CCWGG 1 cut(s) 193
AlwI GGATC 1 cut(s) 12
AlwNI CAGNNNCTG 1 cut(s) 194
AoxI GGCC 1 cut(s) 72
AspLEI GCGC 1 cut(s) 188
AspS9I GGNCC 1 cut(s) 207
AvaII GGWCC 1 cut(s) 207
BamHI GGATCC 1 cut(s) 4
BbsI GAAGAC 1 cut(s) 27
BccI CCATC 1 cut(s) 16
BciT130I CCWGG 1 cut(s) 195
BisI GCNGC 1 cut(s) 75
BlsI GCNGC 1 cut(s) 76
Bme1390I CCNGG 1 cut(s) 195
Bme18I GGWCC 1 cut(s) 207
BmgT120I GGNCC 1 cut(s) 207
BmiI GGNNCC 3 cut(s) 6, 46, 209
BmrFI CCNGG 1 cut(s) 195
BmsI GCATC 1 cut(s) 154
BpiI GAAGAC 1 cut(s) 27
BsaAI YACGTR 1 cut(s) 111
Bsc4I CCNNNNNNNGG 2 cut(s) 136, 217
BseBI CCWGG 1 cut(s) 195
BseGI GGATG 2 cut(s) 8, 23
BseLI CCNNNNNNNGG 2 cut(s) 136, 217
BseRI GAGGAG 1 cut(s) 119
BshFI GGCC 1 cut(s) 74
BsiWI CGTACG 1 cut(s) 107
BslFI GGGAC 1 cut(s) 193
BslI CCNNNNNNNGG 2 cut(s) 136, 217
BsmFI GGGAC 1 cut(s) 193
BsnI GGCC 1 cut(s) 74
Bsp143I GATC 2 cut(s) 4, 82
BspACI CCGC 2 cut(s) 75, 137
BspANI GGCC 1 cut(s) 74
BspLI GGNNCC 3 cut(s) 6, 46, 209
BspPI GGATC 1 cut(s) 12
BssMI GATC 2 cut(s) 4, 82
Bst2UI CCWGG 1 cut(s) 195
Bst6I CTCTTC 1 cut(s) 150
BstBAI YACGTR 1 cut(s) 111
BstF5I GGATG 2 cut(s) 8, 23
BstHHI GCGC 1 cut(s) 188
BstKTI GATC 2 cut(s) 7, 85
BstMBI GATC 2 cut(s) 4, 82
BstNI CCWGG 1 cut(s) 195
BstSCI CCNGG 1 cut(s) 193
BstSNI TACGTA 1 cut(s) 111
BstV2I GAAGAC 1 cut(s) 27
BstX2I RGATCY 1 cut(s) 4
BstYI RGATCY 1 cut(s) 4
BsuRI GGCC 1 cut(s) 74
BtsCI GGATG 2 cut(s) 8, 23
CaiI CAGNNNCTG 1 cut(s) 194
CfoI GCGC 1 cut(s) 188
Cfr13I GGNCC 1 cut(s) 207
Csp6I GTAC 1 cut(s) 108
CviJI RGCY 1 cut(s) 74
CviKI_1 RGCY 1 cut(s) 74
CviQI GTAC 1 cut(s) 108
DpnI GATC 2 cut(s) 6, 84
DpnII GATC 2 cut(s) 4, 82
EaeI YGGCCR 1 cut(s) 72
Eam1104I CTCTTC 1 cut(s) 150
EarI CTCTTC 1 cut(s) 150
EciI GGCGGA 1 cut(s) 152
Eco105I TACGTA 1 cut(s) 111
Eco47I GGWCC 1 cut(s) 207
EcoO109I RGGNCCY 1 cut(s) 207
EcoRII CCWGG 1 cut(s) 193
FaiI YATR 3 cut(s) 60, 114, 203
FaqI GGGAC 1 cut(s) 193
Fnu4HI GCNGC 1 cut(s) 75
FokI GGATG 1 cut(s) 10
Fsp4HI GCNGC 1 cut(s) 75
GlaI GCGC 1 cut(s) 187
GluI GCNGC 1 cut(s) 75
HaeIII GGCC 1 cut(s) 74
HhaI GCGC 1 cut(s) 188
Hin6I GCGC 1 cut(s) 186
HinP1I GCGC 1 cut(s) 186
Hpy188III TCNNGA 1 cut(s) 86
Hpy99I CGWCG 1 cut(s) 155
HpyCH4IV ACGT 1 cut(s) 110
HpySE526I ACGT 1 cut(s) 110
HspAI GCGC 1 cut(s) 186
Kzo9I GATC 2 cut(s) 4, 82
LmnI GCTCC 1 cut(s) 88
LpnPI CCDG 2 cut(s) 180, 207
LweI GCATC 1 cut(s) 154
MaeII ACGT 1 cut(s) 110
MaeIII GTNAC 2 cut(s) 99, 197
MalI GATC 2 cut(s) 6, 84
MboI GATC 2 cut(s) 4, 82
MboII GAAGA 3 cut(s) 12, 27, 167
MflI RGATCY 1 cut(s) 4
MluCI AATT 1 cut(s) 61
MnlI CCTC 5 cut(s) 37, 140, 151, 176, 221
MspR9I CCNGG 1 cut(s) 195
MvaI CCWGG 1 cut(s) 195
NdeII GATC 2 cut(s) 4, 82
NlaIV GGNNCC 3 cut(s) 6, 46, 209
NmuCI GTSAC 1 cut(s) 197
PcsI WCGNNNNNNNCGW 1 cut(s) 159
Pfl23II CGTACG 1 cut(s) 107
PkrI GCNGC 1 cut(s) 76
Ppu21I YACGTR 1 cut(s) 111
PpuMI RGGWCCY 1 cut(s) 207
PsiI TTATAA 1 cut(s) 60
Psp5II RGGWCCY 1 cut(s) 207
Psp6I CCWGG 1 cut(s) 193
PspGI CCWGG 1 cut(s) 193
PspLI CGTACG 1 cut(s) 107
PspN4I GGNNCC 3 cut(s) 6, 46, 209
PspPI GGNCC 1 cut(s) 207
PspPPI RGGWCCY 1 cut(s) 207
PstNI CAGNNNCTG 1 cut(s) 194
PsuI RGATCY 1 cut(s) 4
RsaI GTAC 1 cut(s) 109
RsaNI GTAC 1 cut(s) 108
SatI GCNGC 1 cut(s) 75
Sau3AI GATC 2 cut(s) 4, 82
Sau96I GGNCC 1 cut(s) 207
ScrFI CCNGG 1 cut(s) 195
SetI ASST 2 cut(s) 113, 209
SfaNI GCATC 1 cut(s) 154
SgeI CNNG 7 cut(s) 82, 98, 104, 145, 206, 207, 224
SinI GGWCC 1 cut(s) 207
SnaBI TACGTA 1 cut(s) 111
Sse9I AATT 1 cut(s) 61
SsiI CCGC 2 cut(s) 75, 137
StyD4I CCNGG 1 cut(s) 193
TaiI ACGT 1 cut(s) 113
TaqI TCGA 1 cut(s) 213
TasI AATT 1 cut(s) 61
TauI GCSGC 1 cut(s) 77
TseFI GTSAC 1 cut(s) 197
Tsp45I GTSAC 1 cut(s) 197
TspDTI ATGAA 1 cut(s) 12
VpaK11BI GGWCC 1 cut(s) 207
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.