Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr1

Orthogroup ID

OG0001044

Physical Location & Seq

Genomic Coordinates Forward (+)

1286380 .. 1287563

Gene Structure 1184 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom01g01360.2

Sequence Viewer

CDS Protein Promoter (2k)

Length: 837 bp

ATGCAATTGGAAATCATTTTATTATGCAAGTATAACATGTATGGAGATGAACCCCTTAGCCATTCTATCATCCATTCATTCCATTCCATCAAATTCGTTTTACAATCTGTTTATGAGTTAGAAATCAATTTAGTTTGTGTTTATGAGTGTTTTGATTCATTTTATTTCCCAATTTCGTCCAAATTCACCAAAGTGCTCAAAACTGCCCAGAAAGTGATTTTAAGGCATTTTACATTCTTTGAGTTAGAAATCAATTTAGTTTGTGTTTATGAGTGTTTTGATTCATTTTATTTCCCAATTTCGTCCAAATTCACCAAAGTGCTCAAAACTGCCCAGAAAGTGATTTTAAGGCATTTTGCATTCTTTGAGTCTAGTATAGTGTTTCATATTGTTATTTTACAACGATCCCTACTTATACATATACTACAATTGTCAAAAAGAGGGTTTAATTTGTGCGCGTATAATTCTCGCATCAACGGCCTAGCAAGATTGGCAATGATGGAGCATGGCTCGAATCCTCCATTTCTAAGACATAAAAATCTAAACATTAGAACGATCGGCCAATTGAATTATAACGCCATCTTGACATTAATAGAAGCACCTAAATCTAACATGCTTTGTTCAAATCTAGTGTTTCCAATTATGCATGGGATAGTAAAGCTCCCTGGATCCTTACATTTGGGGGGCAGTTTCCTTTGCAAGATGGCTGAGACGTTTTCACCCACTTTTACAACCTCCTTGGCCGAAATCTTCCTCTTATTAGTGCAAAGTTCCTTCAAGAACTTGGCGTACCTCGGGACTTGCTTGATTGCATCCAAAAGAGGGATATTGACTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

279

Amino Acids

31.8

Weight (kDa)

9.18

Isoelectric Point (pI)

55.68

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001044)

Species	Orthologous Gene IDs
malus_domestica	MD00G1199800.v1.1 MD12G1009800.v1.1
pyrus_communis	pycom01g00360 pycom01g00370 pycom01g01360 pycom01g01490 pycom01g01720 pycom01g01940 pycom01g03060 pycom01g03070 pycom01g03730 pycom01g04350 pycom04g07860 pycom1128g00090 pycom11g16010 pycom12409g00010 pycom12420g00090 pycom12424g00140 pycom12426g00050 pycom12426g00220 pycom12426g00260 pycom12426g00340 pycom12426g00380 pycom12426g00390 pycom12426g00590 pycom12480g00050 pycom12529g00020 pycom12561g00060 pycom1256g00150 pycom1256g00260 pycom12659g00120 pycom12661g00140 pycom12g09700 pycom1341g00110 pycom13g24360 pycom13g25370 pycom13g25380 pycom13g25420 pycom13g25460 pycom13g25840 pycom13g26320 pycom13g28310 pycom13g28320 pycom1654g00080 pycom1654g00130 pycom1654g00140 pycom17g16570 pycom17g16660 pycom17g18490 pycom2238g00030 pycom2246g00120 pycom436g00480 pycom436g00510 pycom576g00010 pycom57g00060 pycom808g00560 pycom808g00650 pycom992g00010
rosa_chinensis	RchiOBHm_Chr0c04g0497971 RchiOBHm_Chr2g0129591 RchiOBHm_Chr7g0215791

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	573
AccII	CGCG	1 cut(s)	458
AclWI	GGATC	3 cut(s)	399, 663, 676
AcoI	YGGCCR	2 cut(s)	559, 741
AcsI	RAATTY	3 cut(s)	92, 182, 308
AfaI	GTAC	1 cut(s)	791
AfiI	CCNNNNNNNGG	1 cut(s)	822
AflIII	ACRYGT	1 cut(s)	36
AgsI	TTSAA	3 cut(s)	568, 624, 778
AjnI	CCWGG	1 cut(s)	664
AleI	CACNNNNGTG	2 cut(s)	191, 317
AluBI	AGCT	1 cut(s)	661
AluI	AGCT	1 cut(s)	661
Alw21I	GWGCWC	2 cut(s)	198, 324
Alw26I	GTCTC	1 cut(s)	704
AlwI	GGATC	3 cut(s)	399, 663, 676
Ama87I	CYCGRG	1 cut(s)	794
AoxI	GGCC	3 cut(s)	478, 559, 741
ApoI	RAATTY	3 cut(s)	92, 182, 308
AseI	ATTAAT	1 cut(s)	590
AspLEI	GCGC	1 cut(s)	458
AsuHPI	GGTGA	3 cut(s)	178, 304, 711
AvaI	CYCGRG	1 cut(s)	794
BamHI	GGATCC	1 cut(s)	668
Bbv12I	GWGCWC	2 cut(s)	198, 324
BccI	CCATC	4 cut(s)	95, 493, 587, 697
BceAI	ACGGC	1 cut(s)	493
BciT130I	CCWGG	1 cut(s)	666
BcoDI	GTCTC	1 cut(s)	704
BfaI	CTAG	3 cut(s)	372, 482, 629
Bme1390I	CCNGG	1 cut(s)	666
BmeT110I	CYCGRG	1 cut(s)	794
BmiI	GGNNCC	1 cut(s)	670
BmrFI	CCNGG	1 cut(s)	666
BmsI	GCATC	2 cut(s)	480, 821
BplI	GAGNNNNNCTC	2 cut(s)	494, 526
Bpu10I	CCTNAGC	1 cut(s)	56
BsaJI	CCNNGG	3 cut(s)	664, 738, 793
Bsc4I	CCNNNNNNNGG	1 cut(s)	822
Bse3DI	GCAATG	1 cut(s)	501
BseBI	CCWGG	1 cut(s)	666
BseDI	CCNNGG	3 cut(s)	664, 738, 793
BseGI	GGATG	2 cut(s)	69, 812
BseLI	CCNNNNNNNGG	1 cut(s)	822
BseMI	GCAATG	1 cut(s)	501
BseMII	CTCAG	1 cut(s)	699
Bsh1236I	CGCG	1 cut(s)	458
Bsh1285I	CGRYCG	1 cut(s)	558
BshFI	GGCC	3 cut(s)	480, 561, 743
BsiEI	CGRYCG	1 cut(s)	558
BsiHKAI	GWGCWC	2 cut(s)	198, 324
BsiHKCI	CYCGRG	1 cut(s)	794
BslFI	GGGAC	1 cut(s)	811
BslI	CCNNNNNNNGG	1 cut(s)	822
BsmAI	GTCTC	1 cut(s)	704
BsmBI	CGTCTC	1 cut(s)	704
BsmFI	GGGAC	1 cut(s)	811
BsmI	GAATGC	1 cut(s)	359
BsnI	GGCC	3 cut(s)	480, 561, 743
BsoBI	CYCGRG	1 cut(s)	794
Bsp1286I	GDGCHC	2 cut(s)	198, 324
Bsp143I	GATC	3 cut(s)	404, 555, 668
BspANI	GGCC	3 cut(s)	480, 561, 743
BspCNI	CTCAG	1 cut(s)	700
BspFNI	CGCG	1 cut(s)	458
BspLI	GGNNCC	1 cut(s)	670
BspPI	GGATC	3 cut(s)	399, 663, 676
BsrDI	GCAATG	1 cut(s)	501
BssECI	CCNNGG	3 cut(s)	664, 738, 793
BssMI	GATC	3 cut(s)	404, 555, 668
BssT1I	CCWWGG	1 cut(s)	738
Bst2UI	CCWGG	1 cut(s)	666
BstDEI	CTNAG	3 cut(s)	56, 527, 708
BstF5I	GGATG	2 cut(s)	69, 812
BstFNI	CGCG	1 cut(s)	458
BstHHI	GCGC	1 cut(s)	458
BstKTI	GATC	3 cut(s)	407, 558, 671
BstMAI	GTCTC	1 cut(s)	704
BstMBI	GATC	3 cut(s)	404, 555, 668
BstMCI	CGRYCG	1 cut(s)	558
BstMWI	GCNNNNNNNGC	2 cut(s)	477, 491
BstNI	CCWGG	1 cut(s)	666
BstNSI	RCATGY	2 cut(s)	40, 616
BstSCI	CCNGG	1 cut(s)	664
BstUI	CGCG	1 cut(s)	458
BstX2I	RGATCY	1 cut(s)	668
BstYI	RGATCY	1 cut(s)	668
BsuRI	GGCC	3 cut(s)	480, 561, 743
BtsCI	GGATG	2 cut(s)	69, 812
CfoI	GCGC	1 cut(s)	458
Csp6I	GTAC	1 cut(s)	790
CviAII	CATG	4 cut(s)	37, 506, 613, 647
CviJI	RGCY	7 cut(s)	60, 480, 510, 561, 661, 707, 743
CviKI_1	RGCY	7 cut(s)	60, 480, 510, 561, 661, 707, 743
CviQI	GTAC	1 cut(s)	790
DdeI	CTNAG	3 cut(s)	56, 527, 708
DpnI	GATC	3 cut(s)	406, 557, 670
DpnII	GATC	3 cut(s)	404, 555, 668
EaeI	YGGCCR	2 cut(s)	559, 741
Eco130I	CCWWGG	1 cut(s)	738
Eco88I	CYCGRG	1 cut(s)	794
EcoRII	CCWGG	1 cut(s)	664
EcoT14I	CCWWGG	1 cut(s)	738
EcoT22I	ATGCAT	1 cut(s)	648
ErhI	CCWWGG	1 cut(s)	738
Esp3I	CGTCTC	1 cut(s)	704
FaeI	CATG	4 cut(s)	40, 509, 616, 650
FaqI	GGGAC	1 cut(s)	811
FatI	CATG	4 cut(s)	36, 505, 612, 646
FokI	GGATG	2 cut(s)	56, 799
FspBI	CTAG	3 cut(s)	372, 482, 629
GlaI	GCGC	1 cut(s)	457
HaeIII	GGCC	3 cut(s)	480, 561, 743
HhaI	GCGC	1 cut(s)	458
Hin1II	CATG	4 cut(s)	40, 509, 616, 650
Hin6I	GCGC	1 cut(s)	456
HinP1I	GCGC	1 cut(s)	456
HinfI	GANTC	4 cut(s)	155, 281, 368, 514
HphI	GGTGA	3 cut(s)	178, 304, 711
Hpy188III	TCNNGA	3 cut(s)	583, 778, 796
HpyAV	CCTTC	1 cut(s)	784
HpyCH4IV	ACGT	1 cut(s)	713
HpyCH4V	TGCA	7 cut(s)	4, 27, 359, 646, 699, 766, 812
HpyF10VI	GCNNNNNNNGC	2 cut(s)	477, 491
HpyF3I	CTNAG	3 cut(s)	56, 527, 708
HpySE526I	ACGT	1 cut(s)	713
Hsp92II	CATG	4 cut(s)	40, 509, 616, 650
HspAI	GCGC	1 cut(s)	456
Kzo9I	GATC	3 cut(s)	404, 555, 668
LmnI	GCTCC	2 cut(s)	502, 666
LpnPI	CCDG	4 cut(s)	221, 347, 651, 678
LweI	GCATC	2 cut(s)	480, 821
MaeI	CTAG	3 cut(s)	372, 482, 629
MaeII	ACGT	1 cut(s)	713
MalI	GATC	3 cut(s)	406, 557, 670
MboI	GATC	3 cut(s)	404, 555, 668
MboII	GAAGA	1 cut(s)	742
MfeI	CAATTG	3 cut(s)	5, 428, 563
MflI	RGATCY	1 cut(s)	668
MhlI	GDGCHC	2 cut(s)	198, 324
MlyI	GAGTC	1 cut(s)	377
MnlI	CCTC	6 cut(s)	434, 528, 745, 764, 803, 815
Mph1103I	ATGCAT	1 cut(s)	648
MseI	TTAA	4 cut(s)	221, 347, 447, 590
MslI	CAYNNNNRTG	2 cut(s)	191, 317
MspR9I	CCNGG	1 cut(s)	666
MunI	CAATTG	3 cut(s)	5, 428, 563
Mva1269I	GAATGC	1 cut(s)	359
MvaI	CCWGG	1 cut(s)	666
MvnI	CGCG	1 cut(s)	458
MwoI	GCNNNNNNNGC	2 cut(s)	477, 491
NdeII	GATC	3 cut(s)	404, 555, 668
NlaIII	CATG	4 cut(s)	40, 509, 616, 650
NlaIV	GGNNCC	1 cut(s)	670
NsiI	ATGCAT	1 cut(s)	648
NspI	RCATGY	2 cut(s)	40, 616
OliI	CACNNNNGTG	2 cut(s)	191, 317
PciI	ACATGT	1 cut(s)	36
PctI	GAATGC	1 cut(s)	359
PfeI	GAWTC	3 cut(s)	155, 281, 514
Ple19I	CGATCG	1 cut(s)	558
PleI	GAGTC	1 cut(s)	376
PpsI	GAGTC	1 cut(s)	376
PscI	ACATGT	1 cut(s)	36
PshBI	ATTAAT	1 cut(s)	590
PsiI	TTATAA	1 cut(s)	573
Psp6I	CCWGG	1 cut(s)	664
PspGI	CCWGG	1 cut(s)	664
PspN4I	GGNNCC	1 cut(s)	670
PsrI	GAACNNNNNNTAC	2 cut(s)	773, 805
PsuI	RGATCY	1 cut(s)	668
PvuI	CGATCG	1 cut(s)	558
RsaI	GTAC	1 cut(s)	791
RsaNI	GTAC	1 cut(s)	790
RseI	CAYNNNNRTG	2 cut(s)	191, 317
SaqAI	TTAA	4 cut(s)	221, 347, 447, 590
Sau3AI	GATC	3 cut(s)	404, 555, 668
SchI	GAGTC	1 cut(s)	377
ScrFI	CCNGG	1 cut(s)	666
SduI	GDGCHC	2 cut(s)	198, 324
SetI	ASST	5 cut(s)	604, 663, 716, 737, 795
SfaNI	GCATC	2 cut(s)	480, 821
SmiMI	CAYNNNNRTG	2 cut(s)	191, 317
SspMI	CTAG	3 cut(s)	372, 482, 629
StyD4I	CCNGG	1 cut(s)	664
StyI	CCWWGG	1 cut(s)	738
TaiI	ACGT	1 cut(s)	716
TaqI	TCGA	1 cut(s)	512
TfiI	GAWTC	3 cut(s)	155, 281, 514
Tru1I	TTAA	4 cut(s)	221, 347, 447, 590
Tru9I	TTAA	4 cut(s)	221, 347, 447, 590
TspDTI	ATGAA	5 cut(s)	63, 66, 147, 273, 374
VspI	ATTAAT	1 cut(s)	590
XapI	RAATTY	3 cut(s)	92, 182, 308
XceI	RCATGY	2 cut(s)	40, 616
XspI	CTAG	3 cut(s)	372, 482, 629
Zsp2I	ATGCAT	1 cut(s)	648

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.