pycom04g07860

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr4
OG0001044
Physical Location & Seq
Reverse (-)
8841678 .. 8841875
198 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom04g07860.1

Sequence Viewer

Length: 198 bp
ATGGAAAAACAAGAATGGTCATCAACGGGATATCTCATAGTTTCAGAAATATTAAAATCAATCACTTCCCCATCGAATTCCATTGTCAAGGTGCCTTTGTATACATCAATCTTCGTTCGGGCCGTCTTCATGAATGGCCTACCAAGGAGAATCGGCAAAGATGTAGAATGGGCTGAATCCTCCATGTCTAGGACGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

7.35

Weight (kDa)

9.3

Isoelectric Point (pI)

47.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 91
AccI GTMKAC 1 cut(s) 101
AcsI RAATTY 1 cut(s) 76
AfiI CCNNNNNNNGG 1 cut(s) 189
AoxI GGCC 2 cut(s) 120, 136
ApoI RAATTY 1 cut(s) 76
AspS9I GGNCC 1 cut(s) 120
BanI GGYRCC 1 cut(s) 91
BbsI GAAGAC 1 cut(s) 118
BccI CCATC 1 cut(s) 79
BceAI ACGGC 1 cut(s) 107
BfaI CTAG 1 cut(s) 189
BmgT120I GGNCC 1 cut(s) 120
BmiI GGNNCC 1 cut(s) 93
BpiI GAAGAC 1 cut(s) 118
BsaJI CCNNGG 1 cut(s) 143
Bsc4I CCNNNNNNNGG 1 cut(s) 189
BseDI CCNNGG 1 cut(s) 143
BseLI CCNNNNNNNGG 1 cut(s) 189
BshFI GGCC 2 cut(s) 122, 138
BshNI GGYRCC 1 cut(s) 91
BslI CCNNNNNNNGG 1 cut(s) 189
BsnI GGCC 2 cut(s) 122, 138
BspANI GGCC 2 cut(s) 122, 138
BspHI TCATGA 1 cut(s) 129
BspLI GGNNCC 1 cut(s) 93
BspT107I GGYRCC 1 cut(s) 91
BssECI CCNNGG 1 cut(s) 143
BssNAI GTATAC 1 cut(s) 102
BssT1I CCWWGG 1 cut(s) 143
Bst1107I GTATAC 1 cut(s) 102
BstV2I GAAGAC 1 cut(s) 118
BstZ17I GTATAC 1 cut(s) 102
BsuRI GGCC 2 cut(s) 122, 138
CciI TCATGA 1 cut(s) 129
Cfr13I GGNCC 1 cut(s) 120
CviAII CATG 2 cut(s) 130, 184
CviJI RGCY 3 cut(s) 122, 138, 173
CviKI_1 RGCY 3 cut(s) 122, 138, 173
Eco130I CCWWGG 1 cut(s) 143
Eco32I GATATC 1 cut(s) 32
EcoRI GAATTC 1 cut(s) 76
EcoRV GATATC 1 cut(s) 32
EcoT14I CCWWGG 1 cut(s) 143
ErhI CCWWGG 1 cut(s) 143
FaeI CATG 2 cut(s) 133, 187
FaiI YATR 4 cut(s) 38, 102, 131, 185
FatI CATG 2 cut(s) 129, 183
FblI GTMKAC 1 cut(s) 101
FspBI CTAG 1 cut(s) 189
HaeIII GGCC 2 cut(s) 122, 138
Hin1II CATG 2 cut(s) 133, 187
HinfI GANTC 2 cut(s) 150, 176
Hpy166II GTNNAC 1 cut(s) 102
Hpy188I TCNGA 1 cut(s) 46
Hpy188III TCNNGA 1 cut(s) 130
Hpy8I GTNNAC 1 cut(s) 102
HpyCH4IV ACGT 1 cut(s) 194
HpySE526I ACGT 1 cut(s) 194
Hsp92II CATG 2 cut(s) 133, 187
MaeI CTAG 1 cut(s) 189
MaeII ACGT 1 cut(s) 194
MboII GAAGA 2 cut(s) 103, 118
MluCI AATT 1 cut(s) 76
MnlI CCTC 1 cut(s) 190
MseI TTAA 1 cut(s) 53
NlaIII CATG 2 cut(s) 133, 187
NlaIV GGNNCC 1 cut(s) 93
PagI TCATGA 1 cut(s) 129
PcsI WCGNNNNNNNCGW 1 cut(s) 120
PfeI GAWTC 2 cut(s) 150, 176
PspN4I GGNNCC 1 cut(s) 93
PspPI GGNCC 1 cut(s) 120
SaqAI TTAA 1 cut(s) 53
Sau96I GGNCC 1 cut(s) 120
SetI ASST 2 cut(s) 93, 197
SgeI CNNG 6 cut(s) 23, 39, 100, 131, 142, 156
Sse9I AATT 1 cut(s) 76
SspI AATATT 1 cut(s) 51
SspMI CTAG 1 cut(s) 189
StyI CCWWGG 1 cut(s) 143
TaiI ACGT 1 cut(s) 197
TaqI TCGA 1 cut(s) 74
TasI AATT 1 cut(s) 76
TfiI GAWTC 2 cut(s) 150, 176
Tru1I TTAA 1 cut(s) 53
Tru9I TTAA 1 cut(s) 53
TspDTI ATGAA 2 cut(s) 118, 146
XapI RAATTY 1 cut(s) 76
XmiI GTMKAC 1 cut(s) 101
XspI CTAG 1 cut(s) 189
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.