pycom808g00650

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00000808
Physical Location & Seq
Forward (+)
402378 .. 402656
279 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom808g00650.1

Sequence Viewer

Length: 279 bp
ATGGCCTTAGTGATGGTTGTTTCCAGGGCGTCCTCGTTCAATTCTTCAAGGTATACCTGCGCCAAAGAATCAATAACATCAATGGAAAAACAAGAATGGTCATCAACGGGATATCTCATGGTTTCAGAAATATTAAAATCAATCACTTCCCCATCGAATTCCATTGTCAAGGTGCCTTTGTATACATCAATCTTCGTTCGGGCCGTCTTCATGAATGGCCTAGCAAGGAGAATCGGCAAAGATGTAGAATGGGCTGAATCCTCCATGTCTAGGACGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

93

Amino Acids

10.25

Weight (kDa)

9.58

Isoelectric Point (pI)

45.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 65
AccB1I GGYRCC 1 cut(s) 172
AccI GTMKAC 2 cut(s) 53, 182
AcsI RAATTY 1 cut(s) 157
AcyI GRCGYC 1 cut(s) 29
AfiI CCNNNNNNNGG 1 cut(s) 270
AgsI TTSAA 2 cut(s) 40, 48
AjnI CCWGG 1 cut(s) 23
AoxI GGCC 3 cut(s) 3, 201, 217
ApoI RAATTY 1 cut(s) 157
AspLEI GCGC 1 cut(s) 62
AspS9I GGNCC 1 cut(s) 201
BanI GGYRCC 1 cut(s) 172
BbsI GAAGAC 1 cut(s) 199
BccI CCATC 2 cut(s) 7, 160
BceAI ACGGC 1 cut(s) 188
BciT130I CCWGG 1 cut(s) 25
BfaI CTAG 2 cut(s) 221, 270
BfuAI ACCTGC 1 cut(s) 65
Bme1390I CCNGG 1 cut(s) 25
BmgT120I GGNCC 1 cut(s) 201
BmiI GGNNCC 1 cut(s) 174
BmrFI CCNGG 1 cut(s) 25
BpiI GAAGAC 1 cut(s) 199
BsaHI GRCGYC 1 cut(s) 29
BsaJI CCNNGG 1 cut(s) 24
Bsc4I CCNNNNNNNGG 1 cut(s) 270
BseBI CCWGG 1 cut(s) 25
BseDI CCNNGG 1 cut(s) 24
BseLI CCNNNNNNNGG 1 cut(s) 270
BshFI GGCC 3 cut(s) 5, 203, 219
BshNI GGYRCC 1 cut(s) 172
BslI CCNNNNNNNGG 1 cut(s) 270
BsnI GGCC 3 cut(s) 5, 203, 219
BspANI GGCC 3 cut(s) 5, 203, 219
BspHI TCATGA 1 cut(s) 210
BspLI GGNNCC 1 cut(s) 174
BspMI ACCTGC 1 cut(s) 65
BspT107I GGYRCC 1 cut(s) 172
BssECI CCNNGG 1 cut(s) 24
BssNAI GTATAC 2 cut(s) 54, 183
BssNI GRCGYC 1 cut(s) 29
Bst1107I GTATAC 2 cut(s) 54, 183
Bst2UI CCWGG 1 cut(s) 25
BstACI GRCGYC 1 cut(s) 29
BstDEI CTNAG 1 cut(s) 7
BstHHI GCGC 1 cut(s) 62
BstNI CCWGG 1 cut(s) 25
BstSCI CCNGG 1 cut(s) 23
BstV2I GAAGAC 1 cut(s) 199
BstZ17I GTATAC 2 cut(s) 54, 183
BsuRI GGCC 3 cut(s) 5, 203, 219
BveI ACCTGC 1 cut(s) 65
CciI TCATGA 1 cut(s) 210
CfoI GCGC 1 cut(s) 62
Cfr13I GGNCC 1 cut(s) 201
CseI GACGC 1 cut(s) 18
CviAII CATG 3 cut(s) 118, 211, 265
CviJI RGCY 4 cut(s) 5, 203, 219, 254
CviKI_1 RGCY 4 cut(s) 5, 203, 219, 254
DdeI CTNAG 1 cut(s) 7
Eco32I GATATC 1 cut(s) 113
EcoRI GAATTC 1 cut(s) 157
EcoRII CCWGG 1 cut(s) 23
EcoRV GATATC 1 cut(s) 113
FaeI CATG 3 cut(s) 121, 214, 268
FaiI YATR 5 cut(s) 54, 119, 183, 212, 266
FatI CATG 3 cut(s) 117, 210, 264
FblI GTMKAC 2 cut(s) 53, 182
FspBI CTAG 2 cut(s) 221, 270
GlaI GCGC 1 cut(s) 61
HaeIII GGCC 3 cut(s) 5, 203, 219
HgaI GACGC 1 cut(s) 18
HhaI GCGC 1 cut(s) 62
Hin1I GRCGYC 1 cut(s) 29
Hin1II CATG 3 cut(s) 121, 214, 268
Hin6I GCGC 1 cut(s) 60
HinP1I GCGC 1 cut(s) 60
HinfI GANTC 3 cut(s) 68, 231, 257
Hpy166II GTNNAC 2 cut(s) 54, 183
Hpy188I TCNGA 1 cut(s) 127
Hpy188III TCNNGA 1 cut(s) 211
Hpy8I GTNNAC 2 cut(s) 54, 183
HpyCH4IV ACGT 1 cut(s) 275
HpyF3I CTNAG 1 cut(s) 7
HpySE526I ACGT 1 cut(s) 275
Hsp92I GRCGYC 1 cut(s) 29
Hsp92II CATG 3 cut(s) 121, 214, 268
HspAI GCGC 1 cut(s) 60
LpnPI CCDG 3 cut(s) 10, 37, 70
MaeI CTAG 2 cut(s) 221, 270
MaeII ACGT 1 cut(s) 275
MboII GAAGA 3 cut(s) 36, 184, 199
MluCI AATT 2 cut(s) 40, 157
MnlI CCTC 2 cut(s) 43, 271
MseI TTAA 1 cut(s) 134
MspR9I CCNGG 1 cut(s) 25
MvaI CCWGG 1 cut(s) 25
NlaIII CATG 3 cut(s) 121, 214, 268
NlaIV GGNNCC 1 cut(s) 174
PagI TCATGA 1 cut(s) 210
PcsI WCGNNNNNNNCGW 1 cut(s) 201
PfeI GAWTC 3 cut(s) 68, 231, 257
Psp6I CCWGG 1 cut(s) 23
PspGI CCWGG 1 cut(s) 23
PspN4I GGNNCC 1 cut(s) 174
PspPI GGNCC 1 cut(s) 201
SaqAI TTAA 1 cut(s) 134
Sau96I GGNCC 1 cut(s) 201
ScrFI CCNGG 1 cut(s) 25
SetI ASST 4 cut(s) 53, 59, 174, 278
Sse9I AATT 2 cut(s) 40, 157
SspI AATATT 1 cut(s) 132
SspMI CTAG 2 cut(s) 221, 270
StyD4I CCNGG 1 cut(s) 23
TaiI ACGT 1 cut(s) 278
TaqI TCGA 1 cut(s) 155
TasI AATT 2 cut(s) 40, 157
TfiI GAWTC 3 cut(s) 68, 231, 257
Tru1I TTAA 1 cut(s) 134
Tru9I TTAA 1 cut(s) 134
TspDTI ATGAA 2 cut(s) 199, 227
XapI RAATTY 1 cut(s) 157
XmiI GTMKAC 2 cut(s) 53, 182
XspI CTAG 2 cut(s) 221, 270
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.