pycom2238g00030

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00002238
Physical Location & Seq
Forward (+)
35577 .. 35921
345 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom2238g00030.1

Sequence Viewer

Length: 345 bp
ATGGCAAAGAATTACTCCTCCTTGCCGTGGCCTTGCATTGGCCCAAATCCTTCATTTTTGCACTCTATGGCCTTAGTGATGGTTGTTTCCAGGGCGTCCTCGTTCAATTCTTCAAGGTATACTTGCGCCAAAGAATCGATAACATCAATGGAAAAACAAGAATGGTCATCAACGGGATATCTCATAGTTTCAGAAATATTAAAATCAATCACTTCCCCATCGAATTCCATTGTCAAGGTGCCTTTGTATACATCAATCTTCGTTCGGGCCGTCTTCATGAATGGCCTACCAAGGAGAATCGGCAAAGATGTAGAATGGGTTGAATCCTCCATGTCTAGGATGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

115

Amino Acids

12.75

Weight (kDa)

9.51

Isoelectric Point (pI)

44.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 238
AccI GTMKAC 2 cut(s) 119, 248
AcsI RAATTY 1 cut(s) 223
AcyI GRCGYC 1 cut(s) 95
AfiI CCNNNNNNNGG 3 cut(s) 27, 38, 336
AgsI TTSAA 3 cut(s) 106, 114, 323
AjnI CCWGG 1 cut(s) 89
AoxI GGCC 5 cut(s) 29, 40, 69, 267, 283
ApoI RAATTY 1 cut(s) 223
AspLEI GCGC 1 cut(s) 128
AspS9I GGNCC 2 cut(s) 41, 267
BanI GGYRCC 1 cut(s) 238
BbsI GAAGAC 1 cut(s) 265
BccI CCATC 2 cut(s) 73, 226
BceAI ACGGC 2 cut(s) 10, 254
BciT130I CCWGG 1 cut(s) 91
BfaI CTAG 1 cut(s) 336
Bme1390I CCNGG 1 cut(s) 91
BmgT120I GGNCC 2 cut(s) 41, 267
BmiI GGNNCC 1 cut(s) 240
BmrFI CCNGG 1 cut(s) 91
BpiI GAAGAC 1 cut(s) 265
Bsa29I ATCGAT 1 cut(s) 137
BsaHI GRCGYC 1 cut(s) 95
BsaJI CCNNGG 3 cut(s) 26, 90, 290
Bsc4I CCNNNNNNNGG 3 cut(s) 27, 38, 336
BseBI CCWGG 1 cut(s) 91
BseCI ATCGAT 1 cut(s) 137
BseDI CCNNGG 3 cut(s) 26, 90, 290
BseGI GGATG 1 cut(s) 345
BseLI CCNNNNNNNGG 3 cut(s) 27, 38, 336
BseRI GAGGAG 1 cut(s) 7
BshFI GGCC 5 cut(s) 31, 42, 71, 269, 285
BshNI GGYRCC 1 cut(s) 238
BshVI ATCGAT 1 cut(s) 137
BslI CCNNNNNNNGG 3 cut(s) 27, 38, 336
BsnI GGCC 5 cut(s) 31, 42, 71, 269, 285
BspANI GGCC 5 cut(s) 31, 42, 71, 269, 285
BspDI ATCGAT 1 cut(s) 137
BspHI TCATGA 1 cut(s) 276
BspLI GGNNCC 1 cut(s) 240
BspT107I GGYRCC 1 cut(s) 238
BssECI CCNNGG 3 cut(s) 26, 90, 290
BssNAI GTATAC 2 cut(s) 120, 249
BssNI GRCGYC 1 cut(s) 95
BssT1I CCWWGG 1 cut(s) 290
Bst1107I GTATAC 2 cut(s) 120, 249
Bst2UI CCWGG 1 cut(s) 91
BstACI GRCGYC 1 cut(s) 95
BstDEI CTNAG 1 cut(s) 73
BstDSI CCRYGG 1 cut(s) 26
BstF5I GGATG 1 cut(s) 345
BstHHI GCGC 1 cut(s) 128
BstNI CCWGG 1 cut(s) 91
BstSCI CCNGG 1 cut(s) 89
BstV2I GAAGAC 1 cut(s) 265
BstZ17I GTATAC 2 cut(s) 120, 249
Bsu15I ATCGAT 1 cut(s) 137
BsuRI GGCC 5 cut(s) 31, 42, 71, 269, 285
BsuTUI ATCGAT 1 cut(s) 137
BtgI CCRYGG 1 cut(s) 26
BtsCI GGATG 1 cut(s) 345
CciI TCATGA 1 cut(s) 276
CfoI GCGC 1 cut(s) 128
Cfr13I GGNCC 2 cut(s) 41, 267
ClaI ATCGAT 1 cut(s) 137
CseI GACGC 1 cut(s) 84
CviAII CATG 2 cut(s) 277, 331
CviJI RGCY 5 cut(s) 31, 42, 71, 269, 285
CviKI_1 RGCY 5 cut(s) 31, 42, 71, 269, 285
DdeI CTNAG 1 cut(s) 73
Eco130I CCWWGG 1 cut(s) 290
Eco32I GATATC 1 cut(s) 179
EcoRI GAATTC 1 cut(s) 223
EcoRII CCWGG 1 cut(s) 89
EcoRV GATATC 1 cut(s) 179
EcoT14I CCWWGG 1 cut(s) 290
ErhI CCWWGG 1 cut(s) 290
FaeI CATG 2 cut(s) 280, 334
FaiI YATR 6 cut(s) 68, 120, 185, 249, 278, 332
FalI AAGNNNNNCTT 2 cut(s) 106, 138
FatI CATG 2 cut(s) 276, 330
FblI GTMKAC 2 cut(s) 119, 248
FspBI CTAG 1 cut(s) 336
GlaI GCGC 1 cut(s) 127
HaeIII GGCC 5 cut(s) 31, 42, 71, 269, 285
HgaI GACGC 1 cut(s) 84
HhaI GCGC 1 cut(s) 128
Hin1I GRCGYC 1 cut(s) 95
Hin1II CATG 2 cut(s) 280, 334
Hin6I GCGC 1 cut(s) 126
HinP1I GCGC 1 cut(s) 126
HinfI GANTC 3 cut(s) 134, 297, 323
Hpy166II GTNNAC 2 cut(s) 120, 249
Hpy188I TCNGA 1 cut(s) 193
Hpy188III TCNNGA 1 cut(s) 277
Hpy8I GTNNAC 2 cut(s) 120, 249
HpyAV CCTTC 1 cut(s) 60
HpyCH4V TGCA 2 cut(s) 36, 61
HpyF3I CTNAG 1 cut(s) 73
Hsp92I GRCGYC 1 cut(s) 95
Hsp92II CATG 2 cut(s) 280, 334
HspAI GCGC 1 cut(s) 126
LpnPI CCDG 2 cut(s) 76, 103
MaeI CTAG 1 cut(s) 336
MboII GAAGA 3 cut(s) 102, 250, 265
MluCI AATT 3 cut(s) 10, 106, 223
MnlI CCTC 3 cut(s) 28, 109, 337
MseI TTAA 1 cut(s) 200
MspR9I CCNGG 1 cut(s) 91
MvaI CCWGG 1 cut(s) 91
NlaIII CATG 2 cut(s) 280, 334
NlaIV GGNNCC 1 cut(s) 240
PagI TCATGA 1 cut(s) 276
PcsI WCGNNNNNNNCGW 1 cut(s) 267
PfeI GAWTC 3 cut(s) 134, 297, 323
Psp6I CCWGG 1 cut(s) 89
PspGI CCWGG 1 cut(s) 89
PspN4I GGNNCC 1 cut(s) 240
PspPI GGNCC 2 cut(s) 41, 267
SaqAI TTAA 1 cut(s) 200
Sau96I GGNCC 2 cut(s) 41, 267
ScrFI CCNGG 1 cut(s) 91
SetI ASST 2 cut(s) 119, 240
Sse9I AATT 3 cut(s) 10, 106, 223
SspI AATATT 1 cut(s) 198
SspMI CTAG 1 cut(s) 336
StyD4I CCNGG 1 cut(s) 89
StyI CCWWGG 1 cut(s) 290
TaqI TCGA 2 cut(s) 137, 221
TasI AATT 3 cut(s) 10, 106, 223
TfiI GAWTC 3 cut(s) 134, 297, 323
Tru1I TTAA 1 cut(s) 200
Tru9I TTAA 1 cut(s) 200
TspDTI ATGAA 3 cut(s) 42, 265, 293
XapI RAATTY 1 cut(s) 223
XmiI GTMKAC 2 cut(s) 119, 248
XspI CTAG 1 cut(s) 336
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.