pycom13g25380

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Forward (+)
22217182 .. 22217457
276 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g25380.1

Sequence Viewer

Length: 276 bp
ATGCCACTAATTCGTTTCCTTAAGAGAATGATCTTTGCAGTGGGAAAGAATTTCTCTAAGAATGCACGTTTCATACTTTCCCAAGAATTTACAGTTCCAGGGGACAATTCAAACAACCAATCTTTGGCCTTGTCCATAAGTGAGAATGGAAAGGCCTTCATCTTCAAAATACTCCCATCAACGTTGATGGGTGTCATACTTGAGCAAACTACTTCAAATTCCTTAAGATGTTTGTTAGGATCTTCCATGGACAACCCATGGAATTTAGGAATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

92

Amino Acids

10.09

Weight (kDa)

9.86

Isoelectric Point (pI)

39.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 124
AclI AACGTT 1 cut(s) 182
AclWI GGATC 1 cut(s) 247
AcsI RAATTY 4 cut(s) 49, 86, 217, 262
AfiI CCNNNNNNNGG 1 cut(s) 124
AflII CTTAAG 2 cut(s) 20, 223
AgsI TTSAA 3 cut(s) 111, 166, 216
AjnI CCWGG 1 cut(s) 97
AlwI GGATC 1 cut(s) 247
AoxI GGCC 2 cut(s) 126, 153
ApoI RAATTY 4 cut(s) 49, 86, 217, 262
BccI CCATC 2 cut(s) 181, 184
BciT130I CCWGG 1 cut(s) 99
BfrI CTTAAG 2 cut(s) 20, 223
Bme1390I CCNGG 1 cut(s) 99
BmrFI CCNGG 1 cut(s) 99
BpuEI CTTGAG 1 cut(s) 221
BsaJI CCNNGG 3 cut(s) 98, 246, 257
Bsc4I CCNNNNNNNGG 1 cut(s) 124
BseBI CCWGG 1 cut(s) 99
BseDI CCNNGG 3 cut(s) 98, 246, 257
BseLI CCNNNNNNNGG 1 cut(s) 124
BshFI GGCC 2 cut(s) 128, 155
BslFI GGGAC 1 cut(s) 116
BslI CCNNNNNNNGG 1 cut(s) 124
BsmFI GGGAC 1 cut(s) 116
BsmI GAATGC 1 cut(s) 67
BsnI GGCC 2 cut(s) 128, 155
Bsp143I GATC 2 cut(s) 30, 239
Bsp19I CCATGG 2 cut(s) 246, 257
BspANI GGCC 2 cut(s) 128, 155
BspPI GGATC 1 cut(s) 247
BspTI CTTAAG 2 cut(s) 20, 223
BssECI CCNNGG 3 cut(s) 98, 246, 257
BssMI GATC 2 cut(s) 30, 239
BssT1I CCWWGG 2 cut(s) 246, 257
Bst2UI CCWGG 1 cut(s) 99
Bst4CI ACNGT 1 cut(s) 94
BstAFI CTTAAG 2 cut(s) 20, 223
BstDEI CTNAG 1 cut(s) 57
BstDSI CCRYGG 2 cut(s) 246, 257
BstKTI GATC 2 cut(s) 33, 242
BstMBI GATC 2 cut(s) 30, 239
BstNI CCWGG 1 cut(s) 99
BstSCI CCNGG 1 cut(s) 97
BstX2I RGATCY 1 cut(s) 239
BstYI RGATCY 1 cut(s) 239
BsuRI GGCC 2 cut(s) 128, 155
BtgI CCRYGG 2 cut(s) 246, 257
BtsI GCAGTG 1 cut(s) 45
BtsIMutI CAGTG 1 cut(s) 45
CviAII CATG 2 cut(s) 247, 258
CviJI RGCY 2 cut(s) 128, 155
CviKI_1 RGCY 2 cut(s) 128, 155
DdeI CTNAG 1 cut(s) 57
DpnI GATC 2 cut(s) 32, 241
DpnII GATC 2 cut(s) 30, 239
Eco130I CCWWGG 2 cut(s) 246, 257
Eco147I AGGCCT 1 cut(s) 155
EcoRII CCWGG 1 cut(s) 97
EcoT14I CCWWGG 2 cut(s) 246, 257
ErhI CCWWGG 2 cut(s) 246, 257
FaeI CATG 2 cut(s) 250, 261
FaiI YATR 6 cut(s) 74, 137, 197, 248, 259, 274
FaqI GGGAC 1 cut(s) 116
FatI CATG 2 cut(s) 246, 257
HaeIII GGCC 2 cut(s) 128, 155
Hin1II CATG 2 cut(s) 250, 261
HpyAV CCTTC 1 cut(s) 166
HpyCH4III ACNGT 1 cut(s) 94
HpyCH4IV ACGT 2 cut(s) 67, 182
HpyCH4V TGCA 2 cut(s) 38, 65
HpyF3I CTNAG 1 cut(s) 57
HpySE526I ACGT 2 cut(s) 67, 182
Hsp92II CATG 2 cut(s) 250, 261
Kzo9I GATC 2 cut(s) 30, 239
LpnPI CCDG 2 cut(s) 84, 111
MaeII ACGT 2 cut(s) 67, 182
MalI GATC 2 cut(s) 32, 241
MboI GATC 2 cut(s) 30, 239
MboII GAAGA 2 cut(s) 154, 234
MflI RGATCY 1 cut(s) 239
MluCI AATT 6 cut(s) 9, 49, 86, 106, 217, 262
MseI TTAA 2 cut(s) 21, 224
MspCI CTTAAG 2 cut(s) 20, 223
MspR9I CCNGG 1 cut(s) 99
Mva1269I GAATGC 1 cut(s) 67
MvaI CCWGG 1 cut(s) 99
NcoI CCATGG 2 cut(s) 246, 257
NdeII GATC 2 cut(s) 30, 239
NlaIII CATG 2 cut(s) 250, 261
PceI AGGCCT 1 cut(s) 155
PctI GAATGC 1 cut(s) 67
PflMI CCANNNNNTGG 1 cut(s) 124
Psp1406I AACGTT 1 cut(s) 182
Psp6I CCWGG 1 cut(s) 97
PspGI CCWGG 1 cut(s) 97
PsuI RGATCY 1 cut(s) 239
SaqAI TTAA 2 cut(s) 21, 224
Sau3AI GATC 2 cut(s) 30, 239
ScrFI CCNGG 1 cut(s) 99
SetI ASST 2 cut(s) 70, 185
SgeI CNNG 8 cut(s) 78, 95, 110, 111, 142, 212, 259, 270
SmlI CTYRAG 3 cut(s) 20, 200, 223
SmoI CTYRAG 3 cut(s) 20, 200, 223
Sse9I AATT 6 cut(s) 9, 49, 86, 106, 217, 262
SseBI AGGCCT 1 cut(s) 155
StuI AGGCCT 1 cut(s) 155
StyD4I CCNGG 1 cut(s) 97
StyI CCWWGG 2 cut(s) 246, 257
TaaI ACNGT 1 cut(s) 94
TaiI ACGT 2 cut(s) 70, 185
TasI AATT 6 cut(s) 9, 49, 86, 106, 217, 262
Tru1I TTAA 2 cut(s) 21, 224
Tru9I TTAA 2 cut(s) 21, 224
TscAI CASTG 1 cut(s) 45
TspDTI ATGAA 2 cut(s) 61, 148
TspRI CASTG 1 cut(s) 45
Van91I CCANNNNNTGG 1 cut(s) 124
Vha464I CTTAAG 2 cut(s) 20, 223
XapI RAATTY 4 cut(s) 49, 86, 217, 262
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.