Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

tig00012426

Orthogroup ID

OG0001044

Physical Location & Seq

Genomic Coordinates Forward (+)

433969 .. 434596

Gene Structure 628 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom12426g00590.3

Sequence Viewer

CDS Protein Promoter (2k)

Length: 525 bp

ATGATTAACCTAATCACACCATCATTTTTTAACTCACCTAGGTTCATAGATTCTAGCATAGCATGTTCAAACCGATTATTGCCAATAACACAAGGAATCGTAAAACTACCCGGATCTTTGCATTTAGGGGGCAATTTACGTTGCAAGATGGCTGAGACATTCTCACTTACCTTTACAACCTCTTTGTTTGAAATTCTCTTCCTAGTAGTACAAAGTTCTTTTAAAAACTTAGCATACCTCGGAACTTGTTTAATTGCATCCAAAAGTGGTATATTGACTTGTACTTTTCTAAACGTCTCTAAAATGTCATTTTCAGCCTCCTCCTTCTTTGTTTGCATGAATCTACGAGGAAAAGGTACATTTGGAGGAATAACATTAGAAATAACCGAATTTGGAACATCCTTACCCTTAGAAGCCGAGTGGTGTACTTTGGGTGGCTGCGGCATGGTGTCTCCCACCCTTGCCGTGGCTTGCTCATGCTCCCCCTCTTCAAATTGCAACTTTTCGTCCTCCATTGGGATGTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

175

Amino Acids

18.52

Weight (kDa)

8.37

Isoelectric Point (pI)

57.03

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001044)

Species	Orthologous Gene IDs
malus_domestica	MD00G1199800.v1.1 MD12G1009800.v1.1
pyrus_communis	pycom01g00360 pycom01g00370 pycom01g01360 pycom01g01490 pycom01g01720 pycom01g01940 pycom01g03060 pycom01g03070 pycom01g03730 pycom01g04350 pycom04g07860 pycom1128g00090 pycom11g16010 pycom12409g00010 pycom12420g00090 pycom12424g00140 pycom12426g00050 pycom12426g00220 pycom12426g00260 pycom12426g00340 pycom12426g00380 pycom12426g00390 pycom12426g00590 pycom12480g00050 pycom12529g00020 pycom12561g00060 pycom1256g00150 pycom1256g00260 pycom12659g00120 pycom12661g00140 pycom12g09700 pycom1341g00110 pycom13g24360 pycom13g25370 pycom13g25380 pycom13g25420 pycom13g25460 pycom13g25840 pycom13g26320 pycom13g28310 pycom13g28320 pycom1654g00080 pycom1654g00130 pycom1654g00140 pycom17g16570 pycom17g16660 pycom17g18490 pycom2238g00030 pycom2246g00120 pycom436g00480 pycom436g00510 pycom576g00010 pycom57g00060 pycom808g00560 pycom808g00650 pycom992g00010
rosa_chinensis	RchiOBHm_Chr0c04g0497971 RchiOBHm_Chr2g0129591 RchiOBHm_Chr7g0215791

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	441
AclWI	GGATC	1 cut(s)	121
AcsI	RAATTY	2 cut(s)	192, 389
AfaI	GTAC	4 cut(s)	210, 283, 358, 427
AfiI	CCNNNNNNNGG	2 cut(s)	466, 516
AgsI	TTSAA	3 cut(s)	69, 191, 492
Alw26I	GTCTC	3 cut(s)	149, 301, 456
AlwI	GGATC	1 cut(s)	121
ApeKI	GCWGC	1 cut(s)	438
ApoI	RAATTY	2 cut(s)	192, 389
AspA2I	CCTAGG	1 cut(s)	38
AsuC2I	CCSGG	1 cut(s)	111
AsuHPI	GGTGA	1 cut(s)	27
AvrII	CCTAGG	1 cut(s)	38
BbvI	GCAGC	1 cut(s)	425
BccI	CCATC	2 cut(s)	28, 142
BceAI	ACGGC	1 cut(s)	449
BcnI	CCSGG	1 cut(s)	111
BcoDI	GTCTC	3 cut(s)	149, 301, 456
BfaI	CTAG	3 cut(s)	39, 54, 203
BisI	GCNGC	2 cut(s)	439, 442
BlnI	CCTAGG	1 cut(s)	38
BlsI	GCNGC	2 cut(s)	440, 443
Bme1390I	CCNGG	1 cut(s)	111
BmrFI	CCNGG	1 cut(s)	111
BmsI	GCATC	1 cut(s)	266
BplI	GAGNNNNNCTC	2 cut(s)	146, 178
BpuMI	CCSGG	1 cut(s)	111
BsaJI	CCNNGG	3 cut(s)	38, 238, 465
Bsc4I	CCNNNNNNNGG	2 cut(s)	466, 516
BseDI	CCNNGG	3 cut(s)	38, 238, 465
BseGI	GGATG	3 cut(s)	257, 398, 525
BseLI	CCNNNNNNNGG	2 cut(s)	466, 516
BseMII	CTCAG	1 cut(s)	144
BseRI	GAGGAG	1 cut(s)	310
BseXI	GCAGC	1 cut(s)	425
BsiSI	CCGG	1 cut(s)	111
BslI	CCNNNNNNNGG	2 cut(s)	466, 516
BsmAI	GTCTC	3 cut(s)	149, 301, 456
BsmBI	CGTCTC	1 cut(s)	301
Bsp143I	GATC	1 cut(s)	113
BspACI	CCGC	1 cut(s)	441
BspCNI	CTCAG	1 cut(s)	145
BspPI	GGATC	1 cut(s)	121
BssECI	CCNNGG	3 cut(s)	38, 238, 465
BssMI	GATC	1 cut(s)	113
BssT1I	CCWWGG	1 cut(s)	38
Bst6I	CTCTTC	2 cut(s)	203, 493
BstC8I	GCNNGC	1 cut(s)	472
BstDEI	CTNAG	3 cut(s)	153, 229, 409
BstDSI	CCRYGG	1 cut(s)	465
BstF5I	GGATG	3 cut(s)	257, 398, 525
BstKTI	GATC	1 cut(s)	116
BstMAI	GTCTC	3 cut(s)	149, 301, 456
BstMBI	GATC	1 cut(s)	113
BstNSI	RCATGY	1 cut(s)	66
BstSCI	CCNGG	1 cut(s)	109
BstV1I	GCAGC	1 cut(s)	425
BstX2I	RGATCY	1 cut(s)	113
BstYI	RGATCY	1 cut(s)	113
BtgI	CCRYGG	1 cut(s)	465
BtsCI	GGATG	3 cut(s)	257, 398, 525
Cac8I	GCNNGC	1 cut(s)	472
Csp6I	GTAC	4 cut(s)	209, 282, 357, 426
CviAII	CATG	4 cut(s)	63, 337, 445, 477
CviJI	RGCY	5 cut(s)	152, 317, 416, 438, 470
CviKI_1	RGCY	5 cut(s)	152, 317, 416, 438, 470
CviQI	GTAC	4 cut(s)	209, 282, 357, 426
DdeI	CTNAG	3 cut(s)	153, 229, 409
DpnI	GATC	1 cut(s)	115
DpnII	GATC	1 cut(s)	113
DraI	TTTAAA	1 cut(s)	223
Eam1104I	CTCTTC	2 cut(s)	203, 493
EarI	CTCTTC	2 cut(s)	203, 493
Eco130I	CCWWGG	1 cut(s)	38
EcoT14I	CCWWGG	1 cut(s)	38
ErhI	CCWWGG	1 cut(s)	38
Esp3I	CGTCTC	1 cut(s)	301
FaeI	CATG	4 cut(s)	66, 340, 448, 480
FaiI	YATR	8 cut(s)	47, 59, 64, 235, 272, 338, 446, 478
FatI	CATG	4 cut(s)	62, 336, 444, 476
Fnu4HI	GCNGC	2 cut(s)	439, 442
FokI	GGATG	2 cut(s)	244, 385
Fsp4HI	GCNGC	2 cut(s)	439, 442
FspBI	CTAG	3 cut(s)	39, 54, 203
GluI	GCNGC	2 cut(s)	439, 442
HapII	CCGG	1 cut(s)	111
Hin1II	CATG	4 cut(s)	66, 340, 448, 480
HinfI	GANTC	3 cut(s)	50, 96, 340
HpaII	CCGG	1 cut(s)	111
HphI	GGTGA	1 cut(s)	27
Hpy166II	GTNNAC	1 cut(s)	426
Hpy188I	TCNGA	1 cut(s)	242
Hpy8I	GTNNAC	1 cut(s)	426
HpyAV	CCTTC	1 cut(s)	334
HpyCH4IV	ACGT	2 cut(s)	139, 294
HpyCH4V	TGCA	5 cut(s)	121, 144, 257, 336, 498
HpyF3I	CTNAG	3 cut(s)	153, 229, 409
HpySE526I	ACGT	2 cut(s)	139, 294
Hsp92II	CATG	4 cut(s)	66, 340, 448, 480
Kzo9I	GATC	1 cut(s)	113
LmnI	GCTCC	1 cut(s)	485
LpnPI	CCDG	1 cut(s)	124
Lsp1109I	GCAGC	1 cut(s)	425
LweI	GCATC	1 cut(s)	266
MaeI	CTAG	3 cut(s)	39, 54, 203
MaeII	ACGT	2 cut(s)	139, 294
MalI	GATC	1 cut(s)	115
MboI	GATC	1 cut(s)	113
MboII	GAAGA	2 cut(s)	190, 480
MflI	RGATCY	1 cut(s)	113
MluCI	AATT	5 cut(s)	133, 192, 252, 389, 493
MnlI	CCTC	8 cut(s)	190, 248, 328, 331, 341, 359, 496, 520
MseI	TTAA	4 cut(s)	6, 30, 222, 251
MslI	CAYNNNNRTG	1 cut(s)	518
MspI	CCGG	1 cut(s)	111
MspR9I	CCNGG	1 cut(s)	111
NciI	CCSGG	1 cut(s)	111
NdeII	GATC	1 cut(s)	113
NlaIII	CATG	4 cut(s)	66, 340, 448, 480
NmeAIII	GCCGAG	1 cut(s)	442
NspI	RCATGY	1 cut(s)	66
PfeI	GAWTC	3 cut(s)	50, 96, 340
PkrI	GCNGC	2 cut(s)	440, 443
PsuI	RGATCY	1 cut(s)	113
RsaI	GTAC	4 cut(s)	210, 283, 358, 427
RsaNI	GTAC	4 cut(s)	209, 282, 357, 426
RseI	CAYNNNNRTG	1 cut(s)	518
SaqAI	TTAA	4 cut(s)	6, 30, 222, 251
SatI	GCNGC	2 cut(s)	439, 442
Sau3AI	GATC	1 cut(s)	113
ScrFI	CCNGG	1 cut(s)	111
SetI	ASST	9 cut(s)	12, 40, 44, 142, 173, 182, 240, 297, 358
SfaNI	GCATC	1 cut(s)	266
SmiMI	CAYNNNNRTG	1 cut(s)	518
Sse9I	AATT	5 cut(s)	133, 192, 252, 389, 493
SsiI	CCGC	1 cut(s)	441
SspMI	CTAG	3 cut(s)	39, 54, 203
StyD4I	CCNGG	1 cut(s)	109
StyI	CCWWGG	1 cut(s)	38
TaiI	ACGT	2 cut(s)	142, 297
TasI	AATT	5 cut(s)	133, 192, 252, 389, 493
TatI	WGTACW	3 cut(s)	208, 281, 425
TauI	GCSGC	1 cut(s)	444
TfiI	GAWTC	3 cut(s)	50, 96, 340
Tru1I	TTAA	4 cut(s)	6, 30, 222, 251
Tru9I	TTAA	4 cut(s)	6, 30, 222, 251
TseI	GCWGC	1 cut(s)	438
TspDTI	ATGAA	2 cut(s)	34, 353
XapI	RAATTY	2 cut(s)	192, 389
XceI	RCATGY	1 cut(s)	66
XcmI	CCANNNNNNNNNTGG	1 cut(s)	463
XmaJI	CCTAGG	1 cut(s)	38
XspI	CTAG	3 cut(s)	39, 54, 203

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.