pycom436g00510

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
SuperScaffold_436
Physical Location & Seq
Forward (+)
593634 .. 593858
225 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom436g00510.1

Sequence Viewer

Length: 225 bp
ATGCATTGTTCAAACTTAGTATTACCAATAACGCACGGAATTGTAAAACTACCCGGATCTTTGCATTTAGGGGGTAATTTCCTTTGTAACACAGCAGAGACATTTTCACTTACCTGGACCACCTCCTTGTTTGAAATCCTCTTCCTCGTTGTGCAAAGCTCTTTTAAGAACTTGGCATACTTAGGGACTTGCTTGATTGCATCAAGGAGCGGAATGTTAACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

8.03

Weight (kDa)

7.78

Isoelectric Point (pI)

34.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 210
AciI CCGC 1 cut(s) 210
AclWI GGATC 1 cut(s) 64
AgsI TTSAA 2 cut(s) 12, 134
AjnI CCWGG 1 cut(s) 113
AluBI AGCT 1 cut(s) 159
AluI AGCT 1 cut(s) 159
Alw26I GTCTC 1 cut(s) 92
AlwI GGATC 1 cut(s) 64
AspS9I GGNCC 1 cut(s) 117
AsuC2I CCSGG 1 cut(s) 54
AvaII GGWCC 1 cut(s) 117
BciT130I CCWGG 1 cut(s) 115
BcnI CCSGG 1 cut(s) 54
BcoDI GTCTC 1 cut(s) 92
Bme1390I CCNGG 2 cut(s) 54, 115
Bme18I GGWCC 1 cut(s) 117
BmgT120I GGNCC 1 cut(s) 117
BmrFI CCNGG 2 cut(s) 54, 115
BmsI GCATC 1 cut(s) 209
BpuMI CCSGG 1 cut(s) 54
BseBI CCWGG 1 cut(s) 115
BsiSI CCGG 1 cut(s) 54
BslFI GGGAC 1 cut(s) 199
BsmAI GTCTC 1 cut(s) 92
BsmFI GGGAC 1 cut(s) 199
Bsp143I GATC 1 cut(s) 56
BspACI CCGC 1 cut(s) 210
BspPI GGATC 1 cut(s) 64
BsrBI CCGCTC 1 cut(s) 210
BssMI GATC 1 cut(s) 56
Bst2UI CCWGG 1 cut(s) 115
Bst6I CTCTTC 1 cut(s) 146
BstDEI CTNAG 2 cut(s) 16, 181
BstKTI GATC 1 cut(s) 59
BstMAI GTCTC 1 cut(s) 92
BstMBI GATC 1 cut(s) 56
BstNI CCWGG 1 cut(s) 115
BstSCI CCNGG 2 cut(s) 52, 113
BstX2I RGATCY 1 cut(s) 56
BstYI RGATCY 1 cut(s) 56
Cfr13I GGNCC 1 cut(s) 117
CviJI RGCY 1 cut(s) 159
CviKI_1 RGCY 1 cut(s) 159
DdeI CTNAG 2 cut(s) 16, 181
DpnI GATC 1 cut(s) 58
DpnII GATC 1 cut(s) 56
Eam1104I CTCTTC 1 cut(s) 146
EarI CTCTTC 1 cut(s) 146
Eco47I GGWCC 1 cut(s) 117
EcoRII CCWGG 1 cut(s) 113
EcoT22I ATGCAT 1 cut(s) 6
FaiI YATR 1 cut(s) 178
FaqI GGGAC 1 cut(s) 199
HapII CCGG 1 cut(s) 54
HincII GTYRAC 1 cut(s) 219
HindII GTYRAC 1 cut(s) 219
HpaI GTTAAC 1 cut(s) 219
HpaII CCGG 1 cut(s) 54
Hpy166II GTNNAC 1 cut(s) 219
Hpy8I GTNNAC 1 cut(s) 219
HpyCH4V TGCA 4 cut(s) 4, 64, 154, 200
HpyF3I CTNAG 2 cut(s) 16, 181
KspAI GTTAAC 1 cut(s) 219
Kzo9I GATC 1 cut(s) 56
LmnI GCTCC 1 cut(s) 207
LpnPI CCDG 3 cut(s) 67, 100, 127
LweI GCATC 1 cut(s) 209
MaeIII GTNAC 1 cut(s) 86
MalI GATC 1 cut(s) 58
MbiI CCGCTC 1 cut(s) 210
MboI GATC 1 cut(s) 56
MboII GAAGA 1 cut(s) 133
MflI RGATCY 1 cut(s) 56
MluCI AATT 2 cut(s) 39, 76
MnlI CCTC 3 cut(s) 133, 149, 155
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 2 cut(s) 165, 218
MspI CCGG 1 cut(s) 54
MspR9I CCNGG 2 cut(s) 54, 115
MvaI CCWGG 1 cut(s) 115
NciI CCSGG 1 cut(s) 54
NdeII GATC 1 cut(s) 56
NsiI ATGCAT 1 cut(s) 6
Psp6I CCWGG 1 cut(s) 113
PspGI CCWGG 1 cut(s) 113
PspPI GGNCC 1 cut(s) 117
PsrI GAACNNNNNNTAC 2 cut(s) 161, 193
PsuI RGATCY 1 cut(s) 56
SaqAI TTAA 2 cut(s) 165, 218
Sau3AI GATC 1 cut(s) 56
Sau96I GGNCC 1 cut(s) 117
ScrFI CCNGG 2 cut(s) 54, 115
SetI ASST 3 cut(s) 116, 125, 161
SfaNI GCATC 1 cut(s) 209
SinI GGWCC 1 cut(s) 117
Sse9I AATT 2 cut(s) 39, 76
SsiI CCGC 1 cut(s) 210
StyD4I CCNGG 2 cut(s) 52, 113
TasI AATT 2 cut(s) 39, 76
Tru1I TTAA 2 cut(s) 165, 218
Tru9I TTAA 2 cut(s) 165, 218
TspGWI ACGGA 1 cut(s) 51
VpaK11BI GGWCC 1 cut(s) 117
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.