pycom01g18540

Metacaspase-1-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
Physical Location & Seq
Forward (+)
17497748 .. 17498040
293 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g18540.1

Sequence Viewer

Length: 183 bp
ATGATCGATCAAACTTCTGCTGATACCTCAGCTTTGTCAAAGATTACTTCGACTGGTGCCATGACTTATGCTTTCATCCAAGCCATCGAGCGTGGACATGGAGATACATATGGTAACATGTTGAATGCAATGATCGATCTACCATCCGTAACACAGACAATGATGTTGGAGGTGGTATTGTGA

Protein Analysis

61

Amino Acids

6.46

Weight (kDa)

4.23

Isoelectric Point (pI)

7.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000588)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G02170
fragaria_vesca FvH4_7g08970 FvH4_7g08970 FvH4_7g08970 FvH4_7g26490
malus_domestica MD01G1173500.v1.1 MD02G1221900.v1.1 MD05G1044000.v1.1 MD07G1094600.v1.1 MD07G1240400.v1.1 MD07G1240500.v1.1 MD10G1051100.v1.1 MD10G1051200.v1.1
prunus_persica Prupe.2G118900_v2.0.a1 Prupe.2G269200_v2.0.a1 Prupe.8G059400_v2.0.a1
pyrus_communis pycom01g18530 pycom01g18540 pycom02g18780 pycom05g03650 pycom07g07790 pycom07g21680 pycom10g03590
rosa_chinensis RchiOBHm_Chr1g0344331 RchiOBHm_Chr1g0344461 RchiOBHm_Chr1g0344571 RchiOBHm_Chr1g0344661 RchiOBHm_Chr1g0344751 RchiOBHm_Chr1g0344811 RchiOBHm_Chr1g0344881 RchiOBHm_Chr1g0344901 RchiOBHm_Chr1g0344911 RchiOBHm_Chr1g0373091
rosa_laevigata RLG00000028867 RLG00000028877 RLG00000028880 RLG00000028885 RLG00000028898
rosa_multiflora Rmu_co8105290.1_g000001 Rmu_co8220756.1_g000001 Rmu_co8317965.1_g000001 Rmu_co8413861.1_g000001 Rmu_co8518347.1_g000001 Rmu_sc0000390.1_g000001 Rmu_sc0005177.1_g000002 Rmu_sc0007317.1_g000002 Rmu_sc0010876.1_g000003 Rmu_sc0013714.1_g000001 Rmu_sc0029558.1_g000002 Rmu_ssc0000167.1_g000004
rosa_roxburghii Rroxscaffold_4G00284470 Rroxscaffold_4G00309530 Rroxscaffold_4G00309580 Rroxscaffold_4G00309590 Rroxscaffold_4G00309620 Rroxscaffold_4G00309630 Rroxscaffold_4G00309720 Rroxscaffold_4G00309880
rosa_rugosa Rorug01G0173200 Rorug01G0173200 Rorug01G0174300 Rorug01G0174300 Rorug01G0174300 Rorug01G0174900 Rorug01G0376100
rosa_samantha Rh1CG175000 Rh1CG176200 Rh1CG177200 Rh1CG177800 Rh1CG177900 Rh1CG178000 Rh1CG361900 Rh1DG188500 Rh1DG188700 Rh1DG189400 Rh1DG379400
rosa_wichuraiana Rw1G015680 Rw1G015800 Rw1G015810 Rw1G015870 Rw1G033900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 56
AflIII ACRYGT 1 cut(s) 117
AgsI TTSAA 1 cut(s) 124
AluBI AGCT 1 cut(s) 32
AluI AGCT 1 cut(s) 32
BanI GGYRCC 1 cut(s) 56
BbvCI CCTCAGC 1 cut(s) 28
BccI CCATC 2 cut(s) 92, 151
BmiI GGNNCC 1 cut(s) 58
Bpu10I CCTNAGC 1 cut(s) 28
Bsa29I ATCGAT 2 cut(s) 6, 135
Bse1I ACTGG 1 cut(s) 58
Bse3DI GCAATG 1 cut(s) 135
BseCI ATCGAT 2 cut(s) 6, 135
BseGI GGATG 2 cut(s) 75, 143
BseMI GCAATG 1 cut(s) 135
BseMII CTCAG 1 cut(s) 42
BseNI ACTGG 1 cut(s) 58
BshNI GGYRCC 1 cut(s) 56
BshVI ATCGAT 2 cut(s) 6, 135
BsmI GAATGC 1 cut(s) 130
Bsp143I GATC 4 cut(s) 3, 7, 132, 136
BspCNI CTCAG 1 cut(s) 41
BspDI ATCGAT 2 cut(s) 6, 135
BspLI GGNNCC 1 cut(s) 58
BspT107I GGYRCC 1 cut(s) 56
BsrDI GCAATG 1 cut(s) 135
BsrI ACTGG 1 cut(s) 58
BssMI GATC 4 cut(s) 3, 7, 132, 136
BstDEI CTNAG 1 cut(s) 28
BstF5I GGATG 2 cut(s) 75, 143
BstKTI GATC 4 cut(s) 6, 10, 135, 139
BstMBI GATC 4 cut(s) 3, 7, 132, 136
BstNSI RCATGY 1 cut(s) 121
Bsu15I ATCGAT 2 cut(s) 6, 135
BsuTUI ATCGAT 2 cut(s) 6, 135
BtsCI GGATG 2 cut(s) 75, 143
ClaI ATCGAT 2 cut(s) 6, 135
CviAII CATG 3 cut(s) 61, 98, 118
CviJI RGCY 2 cut(s) 32, 83
CviKI_1 RGCY 2 cut(s) 32, 83
DdeI CTNAG 1 cut(s) 28
DpnI GATC 4 cut(s) 5, 9, 134, 138
DpnII GATC 4 cut(s) 3, 7, 132, 136
FaeI CATG 3 cut(s) 64, 101, 121
FaiI YATR 6 cut(s) 62, 69, 99, 109, 111, 119
FatI CATG 3 cut(s) 60, 97, 117
FauNDI CATATG 1 cut(s) 109
FokI GGATG 2 cut(s) 62, 130
Hin1II CATG 3 cut(s) 64, 101, 121
Hpy166II GTNNAC 1 cut(s) 95
Hpy8I GTNNAC 1 cut(s) 95
HpyCH4V TGCA 1 cut(s) 128
HpyF3I CTNAG 1 cut(s) 28
Hsp92II CATG 3 cut(s) 64, 101, 121
Kzo9I GATC 4 cut(s) 3, 7, 132, 136
LpnPI CCDG 1 cut(s) 39
MaeIII GTNAC 2 cut(s) 113, 148
MalI GATC 4 cut(s) 5, 9, 134, 138
MboI GATC 4 cut(s) 3, 7, 132, 136
MmeI TCCRAC 1 cut(s) 147
MnlI CCTC 2 cut(s) 37, 163
Mva1269I GAATGC 1 cut(s) 130
NdeI CATATG 1 cut(s) 109
NdeII GATC 4 cut(s) 3, 7, 132, 136
NlaIII CATG 3 cut(s) 64, 101, 121
NlaIV GGNNCC 1 cut(s) 58
NspI RCATGY 1 cut(s) 121
PciI ACATGT 1 cut(s) 117
PctI GAATGC 1 cut(s) 130
PscI ACATGT 1 cut(s) 117
PspN4I GGNNCC 1 cut(s) 58
Sau3AI GATC 4 cut(s) 3, 7, 132, 136
SetI ASST 3 cut(s) 29, 34, 174
SgeI CNNG 7 cut(s) 66, 73, 92, 100, 104, 110, 130
TaqI TCGA 4 cut(s) 6, 50, 87, 135
TspDTI ATGAA 1 cut(s) 64
TspGWI ACGGA 1 cut(s) 136
XceI RCATGY 1 cut(s) 121
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.