pycom07g17390
RLK Family

Cysteine-rich RLK (RECEPTOR-like protein kinase) 8

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
Physical Location & Seq
Reverse (-)
19899432 .. 19899716
285 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g17390.1

Sequence Viewer

Length: 285 bp
ATGGTTTCTCTAGGTTTGTATGGATTTAAACCTATAGTGAATAAATCAAATACCTTTTATGTATTTGTCAAGTTCCACGATTTTGTGTTTAATCAGTTCAATACCATTATTAAATGTTTCCAATCTAATGGTGGAGGGGAATACATGAGTAATACGTTCAAGAACTTTCTGGTAAATAAAGGAATTACTCATCAAGTGTCTTGTCCCCATACCCCTCAGCAAAATGGAATTGCTGAGAAGAAGCATAAACACTTAGTTAAGACAGCTTTGACTTTGATGATATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

95

Amino Acids

10.71

Weight (kDa)

9.7

Isoelectric Point (pI)

27.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 100, 160
AluBI AGCT 1 cut(s) 266
AluI AGCT 1 cut(s) 266
BbvCI CCTCAGC 1 cut(s) 216
BfaI CTAG 1 cut(s) 11
BfmI CTRYAG 1 cut(s) 33
Bpu10I CCTNAGC 1 cut(s) 216
BseMII CTCAG 2 cut(s) 225, 230
BslFI GGGAC 1 cut(s) 189
BsmFI GGGAC 1 cut(s) 189
BspCNI CTCAG 2 cut(s) 226, 229
BstDEI CTNAG 3 cut(s) 216, 234, 253
BstSFI CTRYAG 1 cut(s) 33
BstXI CCANNNNNNTGG 1 cut(s) 128
CviAII CATG 1 cut(s) 145
CviJI RGCY 1 cut(s) 266
CviKI_1 RGCY 1 cut(s) 266
DdeI CTNAG 3 cut(s) 216, 234, 253
DraI TTTAAA 1 cut(s) 28
FaeI CATG 1 cut(s) 148
FaiI YATR 7 cut(s) 21, 35, 60, 146, 210, 246, 283
FaqI GGGAC 1 cut(s) 189
FatI CATG 1 cut(s) 144
FspBI CTAG 1 cut(s) 11
Hin1II CATG 1 cut(s) 148
Hpy188III TCNNGA 1 cut(s) 160
HpyCH4IV ACGT 1 cut(s) 155
HpyF3I CTNAG 3 cut(s) 216, 234, 253
HpySE526I ACGT 1 cut(s) 155
Hsp92II CATG 1 cut(s) 148
LpnPI CCDG 1 cut(s) 155
MaeI CTAG 1 cut(s) 11
MaeII ACGT 1 cut(s) 155
MboII GAAGA 1 cut(s) 250
MluCI AATT 2 cut(s) 183, 228
MnlI CCTC 2 cut(s) 128, 225
MseI TTAA 4 cut(s) 27, 90, 111, 258
NlaIII CATG 1 cut(s) 148
SaqAI TTAA 4 cut(s) 27, 90, 111, 258
SetI ASST 5 cut(s) 16, 34, 56, 158, 268
SfcI CTRYAG 1 cut(s) 33
SgeI CNNG 8 cut(s) 23, 82, 89, 157, 172, 182, 206, 213
Sse9I AATT 2 cut(s) 183, 228
SspMI CTAG 1 cut(s) 11
TaiI ACGT 1 cut(s) 158
TasI AATT 2 cut(s) 183, 228
Tru1I TTAA 4 cut(s) 27, 90, 111, 258
Tru9I TTAA 4 cut(s) 27, 90, 111, 258
XcmI CCANNNNNNNNNTGG 1 cut(s) 128
XspI CTAG 1 cut(s) 11
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.