Rroxscaffold_1G00042070

Belongs to the disease resistance NB-LRR family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
60070518 .. 60070830
313 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00042070.1

Sequence Viewer

Length: 249 bp
ATGCCGCTTTATTGTGATAATAAAGCTGCAATTGAAATTGCTCACAATCTCGTTCAGCACGATCGCACGAAACATGTGGAGGTAGATCGACACTTCATTAAAGAAAAGCTGGATGGACAGATCATTTTGTTTCCCTTCGTTCCTACCGAAGAACGGTTGGCGTATATTCTTACAAAGGCTCTCTCGACTAAAGCTTTTTATGACTCACTTGACAAGTTGGGCATCCGTGATCCGTATGCACCAACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

82

Amino Acids

9.48

Weight (kDa)

6.39

Isoelectric Point (pI)

54.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 5
AclWI GGATC 1 cut(s) 224
AfiI CCNNNNNNNGG 1 cut(s) 153
AflIII ACRYGT 1 cut(s) 73
AgsI TTSAA 1 cut(s) 35
AluBI AGCT 3 cut(s) 26, 109, 194
AluI AGCT 3 cut(s) 26, 109, 194
AlwI GGATC 1 cut(s) 224
ApeKI GCWGC 1 cut(s) 26
BbvI GCAGC 1 cut(s) 13
BccI CCATC 1 cut(s) 107
BisI GCNGC 2 cut(s) 5, 27
BlsI GCNGC 2 cut(s) 6, 28
BmsI GCATC 1 cut(s) 231
Bsc4I CCNNNNNNNGG 1 cut(s) 153
BseGI GGATG 2 cut(s) 118, 222
BseLI CCNNNNNNNGG 1 cut(s) 153
BseXI GCAGC 1 cut(s) 13
Bsh1285I CGRYCG 1 cut(s) 64
BsiEI CGRYCG 1 cut(s) 64
BslI CCNNNNNNNGG 1 cut(s) 153
Bsp143I GATC 4 cut(s) 61, 85, 120, 229
BspACI CCGC 1 cut(s) 5
BspPI GGATC 1 cut(s) 224
BssMI GATC 4 cut(s) 61, 85, 120, 229
Bst4CI ACNGT 1 cut(s) 156
BstF5I GGATG 2 cut(s) 118, 222
BstKTI GATC 4 cut(s) 64, 88, 123, 232
BstMBI GATC 4 cut(s) 61, 85, 120, 229
BstMCI CGRYCG 1 cut(s) 64
BstNSI RCATGY 1 cut(s) 77
BstV1I GCAGC 1 cut(s) 13
BtsCI GGATG 2 cut(s) 118, 222
CviAII CATG 1 cut(s) 74
CviJI RGCY 4 cut(s) 26, 109, 179, 194
CviKI_1 RGCY 4 cut(s) 26, 109, 179, 194
DpnI GATC 4 cut(s) 63, 87, 122, 231
DpnII GATC 4 cut(s) 61, 85, 120, 229
FaeI CATG 1 cut(s) 77
FaiI YATR 4 cut(s) 75, 165, 201, 237
FatI CATG 1 cut(s) 73
Fnu4HI GCNGC 2 cut(s) 5, 27
FokI GGATG 2 cut(s) 125, 209
Fsp4HI GCNGC 2 cut(s) 5, 27
GluI GCNGC 2 cut(s) 5, 27
Hin1II CATG 1 cut(s) 77
HindIII AAGCTT 1 cut(s) 192
HinfI GANTC 1 cut(s) 203
Hpy188III TCNNGA 1 cut(s) 184
HpyAV CCTTC 1 cut(s) 145
HpyCH4III ACNGT 1 cut(s) 156
HpyCH4V TGCA 2 cut(s) 29, 239
Hsp92II CATG 1 cut(s) 77
Kzo9I GATC 4 cut(s) 61, 85, 120, 229
LpnPI CCDG 1 cut(s) 95
Lsp1109I GCAGC 1 cut(s) 13
LweI GCATC 1 cut(s) 231
MalI GATC 4 cut(s) 63, 87, 122, 231
MboI GATC 4 cut(s) 61, 85, 120, 229
MboII GAAGA 1 cut(s) 161
MfeI CAATTG 1 cut(s) 30
MluCI AATT 2 cut(s) 30, 36
MlyI GAGTC 1 cut(s) 197
MnlI CCTC 1 cut(s) 73
MseI TTAA 1 cut(s) 99
MunI CAATTG 1 cut(s) 30
NdeII GATC 4 cut(s) 61, 85, 120, 229
NlaIII CATG 1 cut(s) 77
NspI RCATGY 1 cut(s) 77
PciI ACATGT 1 cut(s) 73
PcsI WCGNNNNNNNCGW 2 cut(s) 57, 144
PkrI GCNGC 2 cut(s) 6, 28
Ple19I CGATCG 1 cut(s) 64
PleI GAGTC 1 cut(s) 197
PpsI GAGTC 1 cut(s) 197
PscI ACATGT 1 cut(s) 73
PvuI CGATCG 1 cut(s) 64
SaqAI TTAA 1 cut(s) 99
SatI GCNGC 2 cut(s) 5, 27
Sau3AI GATC 4 cut(s) 61, 85, 120, 229
SchI GAGTC 1 cut(s) 197
SetI ASST 4 cut(s) 28, 84, 111, 196
SfaNI GCATC 1 cut(s) 231
SgeI CNNG 9 cut(s) 62, 71, 79, 86, 122, 196, 221, 226, 239
Sse9I AATT 2 cut(s) 30, 36
SsiI CCGC 1 cut(s) 5
TaaI ACNGT 1 cut(s) 156
TaqI TCGA 2 cut(s) 88, 185
TasI AATT 2 cut(s) 30, 36
TauI GCSGC 1 cut(s) 7
Tru1I TTAA 1 cut(s) 99
Tru9I TTAA 1 cut(s) 99
TseI GCWGC 1 cut(s) 26
TspDTI ATGAA 1 cut(s) 85
TspGWI ACGGA 2 cut(s) 215, 222
XceI RCATGY 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.