pycom15g23320

F-box domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
OG0000947
Physical Location & Seq
Reverse (-)
17379560 .. 17379922
363 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g23320.1

Sequence Viewer

Length: 363 bp
ATGGGATGTCTTGGGGTGTCAAAGGATCTTGTTTGTTATGTAACATGTGATGGTTCAAATACTTTTTGTTTTTGGTCTTATAATGATCGACGTGAATCTGGTGACCAATGGACTCTCAAATATAGTGTTGTTAGGAATAGTTTGGTATGGGGGGCGGATACAATGTTTATACCTGGTGCAGATATGGTGTTTAAACCCTATGCAATGAGTCTGAATGCTCATGTCATCTTCTATAGCACTTTAGAATTGATCTTTAGCTGGGACTTTGAAAGCCAGAAATGTAAACTGTTCAACAAGTCAAAGGTGAAGATGGCCCAAAACCTGGTTATGACTTTCCTTTCTTCACCTAACGTGCTTGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box F-box-like

Protein Analysis

121

Amino Acids

13.69

Weight (kDa)

7.58

Isoelectric Point (pI)

30.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 81
AccB7I CCANNNNNTGG 1 cut(s) 322
AciI CCGC 1 cut(s) 155
AclWI GGATC 1 cut(s) 33
AfiI CCNNNNNNNGG 1 cut(s) 322
AflIII ACRYGT 1 cut(s) 44
AgsI TTSAA 3 cut(s) 57, 269, 292
AjiI CACGTC 1 cut(s) 92
AjnI CCWGG 2 cut(s) 172, 321
AluBI AGCT 1 cut(s) 258
AluI AGCT 1 cut(s) 258
AlwI GGATC 1 cut(s) 33
AoxI GGCC 1 cut(s) 312
AspS9I GGNCC 1 cut(s) 313
AsuHPI GGTGA 3 cut(s) 113, 316, 336
BccI CCATC 2 cut(s) 44, 304
BciT130I CCWGG 2 cut(s) 174, 323
BciVI GTATCC 1 cut(s) 151
BfmI CTRYAG 1 cut(s) 232
BfuI GTATCC 1 cut(s) 151
Bme1390I CCNGG 2 cut(s) 174, 323
BmgBI CACGTC 1 cut(s) 92
BmgT120I GGNCC 1 cut(s) 313
BmrFI CCNGG 2 cut(s) 174, 323
Bsc4I CCNNNNNNNGG 1 cut(s) 322
Bse3DI GCAATG 1 cut(s) 210
BseBI CCWGG 2 cut(s) 174, 323
BseGI GGATG 1 cut(s) 11
BseLI CCNNNNNNNGG 1 cut(s) 322
BseMI GCAATG 1 cut(s) 210
BseYI CCCAGC 1 cut(s) 258
BsgI GTGCAG 1 cut(s) 198
BshFI GGCC 1 cut(s) 314
BslFI GGGAC 1 cut(s) 275
BslI CCNNNNNNNGG 1 cut(s) 322
BsmFI GGGAC 1 cut(s) 275
BsmI GAATGC 1 cut(s) 220
BsnI GGCC 1 cut(s) 314
Bsp143I GATC 3 cut(s) 25, 85, 249
BspACI CCGC 1 cut(s) 155
BspANI GGCC 1 cut(s) 314
BspPI GGATC 1 cut(s) 33
BsrDI GCAATG 1 cut(s) 210
BssMI GATC 3 cut(s) 25, 85, 249
Bst2UI CCWGG 2 cut(s) 174, 323
Bst4CI ACNGT 1 cut(s) 288
BstC8I GCNNGC 1 cut(s) 357
BstEII GGTNACC 1 cut(s) 101
BstF5I GGATG 1 cut(s) 11
BstKTI GATC 3 cut(s) 28, 88, 252
BstMBI GATC 3 cut(s) 25, 85, 249
BstNI CCWGG 2 cut(s) 174, 323
BstNSI RCATGY 1 cut(s) 48
BstPI GGTNACC 1 cut(s) 101
BstSCI CCNGG 2 cut(s) 172, 321
BstSFI CTRYAG 1 cut(s) 232
BstX2I RGATCY 1 cut(s) 25
BstYI RGATCY 1 cut(s) 25
BsuI GTATCC 1 cut(s) 151
BsuRI GGCC 1 cut(s) 314
BtrI CACGTC 1 cut(s) 92
BtsCI GGATG 1 cut(s) 11
Cac8I GCNNGC 1 cut(s) 357
Cfr13I GGNCC 1 cut(s) 313
CsiI ACCWGGT 2 cut(s) 172, 321
CviAII CATG 2 cut(s) 45, 221
CviJI RGCY 3 cut(s) 258, 273, 314
CviKI_1 RGCY 3 cut(s) 258, 273, 314
DpnI GATC 3 cut(s) 27, 87, 251
DpnII GATC 3 cut(s) 25, 85, 249
DraI TTTAAA 1 cut(s) 193
EciI GGCGGA 1 cut(s) 170
Eco91I GGTNACC 1 cut(s) 101
EcoO65I GGTNACC 1 cut(s) 101
EcoRII CCWGG 2 cut(s) 172, 321
FaeI CATG 2 cut(s) 48, 224
FaqI GGGAC 1 cut(s) 275
FatI CATG 2 cut(s) 44, 220
FokI GGATG 1 cut(s) 18
GsaI CCCAGC 1 cut(s) 262
HaeIII GGCC 1 cut(s) 314
Hin1II CATG 2 cut(s) 48, 224
HinfI GANTC 3 cut(s) 95, 112, 208
HphI GGTGA 3 cut(s) 113, 316, 336
Hpy166II GTNNAC 1 cut(s) 284
Hpy188I TCNGA 1 cut(s) 213
Hpy8I GTNNAC 1 cut(s) 284
Hpy99I CGWCG 1 cut(s) 93
HpyCH4III ACNGT 1 cut(s) 288
HpyCH4IV ACGT 2 cut(s) 91, 351
HpyCH4V TGCA 2 cut(s) 179, 203
HpySE526I ACGT 2 cut(s) 91, 351
Hsp92II CATG 2 cut(s) 48, 224
Kzo9I GATC 3 cut(s) 25, 85, 249
LpnPI CCDG 7 cut(s) 84, 159, 186, 244, 287, 308, 335
MabI ACCWGGT 2 cut(s) 172, 321
MaeII ACGT 2 cut(s) 91, 351
MaeIII GTNAC 2 cut(s) 40, 101
MalI GATC 3 cut(s) 27, 87, 251
MboI GATC 3 cut(s) 25, 85, 249
MboII GAAGA 3 cut(s) 220, 319, 333
MflI RGATCY 1 cut(s) 25
MluCI AATT 1 cut(s) 245
MlyI GAGTC 2 cut(s) 106, 217
MseI TTAA 1 cut(s) 192
MspR9I CCNGG 2 cut(s) 174, 323
MssI GTTTAAAC 1 cut(s) 193
Mva1269I GAATGC 1 cut(s) 220
MvaI CCWGG 2 cut(s) 174, 323
NdeII GATC 3 cut(s) 25, 85, 249
NlaIII CATG 2 cut(s) 48, 224
NmuCI GTSAC 1 cut(s) 101
NspI RCATGY 1 cut(s) 48
PciI ACATGT 1 cut(s) 44
PctI GAATGC 1 cut(s) 220
PfeI GAWTC 1 cut(s) 95
PflMI CCANNNNNTGG 1 cut(s) 322
PleI GAGTC 2 cut(s) 106, 216
PmeI GTTTAAAC 1 cut(s) 193
PpsI GAGTC 2 cut(s) 106, 216
PscI ACATGT 1 cut(s) 44
PsiI TTATAA 1 cut(s) 81
Psp6I CCWGG 2 cut(s) 172, 321
PspEI GGTNACC 1 cut(s) 101
PspFI CCCAGC 1 cut(s) 258
PspGI CCWGG 2 cut(s) 172, 321
PspPI GGNCC 1 cut(s) 313
PsuI RGATCY 1 cut(s) 25
SaqAI TTAA 1 cut(s) 192
Sau3AI GATC 3 cut(s) 25, 85, 249
Sau96I GGNCC 1 cut(s) 313
SchI GAGTC 2 cut(s) 106, 217
ScrFI CCNGG 2 cut(s) 174, 323
SetI ASST 7 cut(s) 94, 175, 260, 306, 324, 349, 354
SexAI ACCWGGT 2 cut(s) 172, 321
SfcI CTRYAG 1 cut(s) 232
Sse9I AATT 1 cut(s) 245
SsiI CCGC 1 cut(s) 155
StyD4I CCNGG 2 cut(s) 172, 321
TaaI ACNGT 1 cut(s) 288
TaiI ACGT 2 cut(s) 94, 354
TaqI TCGA 1 cut(s) 88
TasI AATT 1 cut(s) 245
TfiI GAWTC 1 cut(s) 95
Tru1I TTAA 1 cut(s) 192
Tru9I TTAA 1 cut(s) 192
TseFI GTSAC 1 cut(s) 101
Tsp45I GTSAC 1 cut(s) 101
Van91I CCANNNNNTGG 1 cut(s) 322
XceI RCATGY 1 cut(s) 48
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.