Rh5BG333000

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
OG0000947
Physical Location & Seq
Forward (+)
46308842 .. 46309123
282 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG333000.1

Sequence Viewer

Length: 282 bp
ATGAGTTGGGATTGTGCCGGAGAGGTGTTGGATGAAACGACGACGAGTGTGGCATGGCAGTTGTGGTGGGTGACCAGGGAGCTGGCGACCTCCATTAAGGGGATGAGGTGGCCCATGCCGGGGCTTGGGACTAGCAACACATGTGGTTTTGAGCTCATCTCCGCCATGAAATTCAGTCTGGAACTCCTGAATCAAATCTTAGTTTGGGAACTTGGGTGGGGAAGCACATACAGCACATGTGCTTTTCATTCAAGAAAAATTAAGATGAGCATAAAAGCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

93

Amino Acids

10.52

Weight (kDa)

6.54

Isoelectric Point (pI)

29.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 162
AcsI RAATTY 1 cut(s) 170
AfiI CCNNNNNNNGG 4 cut(s) 99, 119, 120, 125
AflIII ACRYGT 2 cut(s) 140, 236
AgsI TTSAA 1 cut(s) 252
AjnI CCWGG 1 cut(s) 74
AluBI AGCT 2 cut(s) 82, 154
AluI AGCT 2 cut(s) 82, 154
Alw21I GWGCWC 1 cut(s) 156
AoxI GGCC 1 cut(s) 110
ApoI RAATTY 1 cut(s) 170
AspS9I GGNCC 1 cut(s) 111
AsuC2I CCSGG 1 cut(s) 120
AsuHPI GGTGA 1 cut(s) 82
BanII GRGCYC 1 cut(s) 156
Bbv12I GWGCWC 1 cut(s) 156
BciT130I CCWGG 1 cut(s) 76
BcnI CCSGG 1 cut(s) 120
BfaI CTAG 1 cut(s) 132
Bme1390I CCNGG 2 cut(s) 76, 120
BmgT120I GGNCC 1 cut(s) 111
BmrFI CCNGG 2 cut(s) 76, 120
BplI GAGNNNNNCTC 2 cut(s) 143, 175
BpuMI CCSGG 1 cut(s) 120
BsaJI CCNNGG 2 cut(s) 75, 119
Bsc4I CCNNNNNNNGG 4 cut(s) 99, 119, 120, 125
BseBI CCWGG 1 cut(s) 76
BseDI CCNNGG 2 cut(s) 75, 119
BseGI GGATG 2 cut(s) 37, 108
BseLI CCNNNNNNNGG 4 cut(s) 99, 119, 120, 125
BshFI GGCC 1 cut(s) 112
BsiHKAI GWGCWC 1 cut(s) 156
BsiSI CCGG 2 cut(s) 18, 119
BslFI GGGAC 1 cut(s) 142
BslI CCNNNNNNNGG 4 cut(s) 99, 119, 120, 125
BsmFI GGGAC 1 cut(s) 142
BsnI GGCC 1 cut(s) 112
Bsp1286I GDGCHC 1 cut(s) 156
BspACI CCGC 1 cut(s) 162
BspANI GGCC 1 cut(s) 112
BssECI CCNNGG 2 cut(s) 75, 119
Bst2UI CCWGG 1 cut(s) 76
BstC8I GCNNGC 1 cut(s) 84
BstDEI CTNAG 1 cut(s) 199
BstEII GGTNACC 1 cut(s) 70
BstF5I GGATG 2 cut(s) 37, 108
BstMWI GCNNNNNNNGC 1 cut(s) 231
BstNI CCWGG 1 cut(s) 76
BstNSI RCATGY 2 cut(s) 144, 240
BstPI GGTNACC 1 cut(s) 70
BstSCI CCNGG 2 cut(s) 74, 118
BstXI CCANNNNNNTGG 1 cut(s) 82
BsuRI GGCC 1 cut(s) 112
BtsCI GGATG 2 cut(s) 37, 108
Cac8I GCNNGC 1 cut(s) 84
Cfr13I GGNCC 1 cut(s) 111
CspCI CAANNNNNGTGG 2 cut(s) 124, 159
CviAII CATG 5 cut(s) 54, 115, 141, 166, 237
CviJI RGCY 4 cut(s) 82, 112, 124, 154
CviKI_1 RGCY 4 cut(s) 82, 112, 124, 154
DdeI CTNAG 1 cut(s) 199
EciI GGCGGA 1 cut(s) 151
Ecl136II GAGCTC 1 cut(s) 154
Eco24I GRGCYC 1 cut(s) 156
Eco53kI GAGCTC 1 cut(s) 154
Eco91I GGTNACC 1 cut(s) 70
EcoICRI GAGCTC 1 cut(s) 154
EcoO65I GGTNACC 1 cut(s) 70
EcoRII CCWGG 1 cut(s) 74
EcoT38I GRGCYC 1 cut(s) 156
FaeI CATG 5 cut(s) 57, 118, 144, 169, 240
FaiI YATR 8 cut(s) 55, 116, 142, 167, 229, 238, 272, 280
FaqI GGGAC 1 cut(s) 142
FatI CATG 5 cut(s) 53, 114, 140, 165, 236
FokI GGATG 2 cut(s) 44, 115
FriOI GRGCYC 1 cut(s) 156
FspBI CTAG 1 cut(s) 132
HaeIII GGCC 1 cut(s) 112
HapII CCGG 2 cut(s) 18, 119
Hin1II CATG 5 cut(s) 57, 118, 144, 169, 240
HinfI GANTC 1 cut(s) 190
HpaII CCGG 2 cut(s) 18, 119
HphI GGTGA 1 cut(s) 82
Hpy188III TCNNGA 3 cut(s) 179, 187, 252
Hpy99I CGWCG 2 cut(s) 43, 46
HpyF10VI GCNNNNNNNGC 1 cut(s) 231
HpyF3I CTNAG 1 cut(s) 199
Hsp92II CATG 5 cut(s) 57, 118, 144, 169, 240
LmnI GCTCC 1 cut(s) 79
LpnPI CCDG 7 cut(s) 31, 61, 68, 88, 132, 164, 200
MaeI CTAG 1 cut(s) 132
MaeIII GTNAC 1 cut(s) 70
MhlI GDGCHC 1 cut(s) 156
MluCI AATT 2 cut(s) 170, 258
MmeI TCCRAC 1 cut(s) 9
MnlI CCTC 3 cut(s) 16, 99, 100
MseI TTAA 2 cut(s) 96, 261
MspI CCGG 2 cut(s) 18, 119
MspR9I CCNGG 2 cut(s) 76, 120
MvaI CCWGG 1 cut(s) 76
MwoI GCNNNNNNNGC 1 cut(s) 231
NciI CCSGG 1 cut(s) 120
NlaIII CATG 5 cut(s) 57, 118, 144, 169, 240
NmuCI GTSAC 1 cut(s) 70
NspI RCATGY 2 cut(s) 144, 240
PciI ACATGT 2 cut(s) 140, 236
PfeI GAWTC 1 cut(s) 190
PscI ACATGT 2 cut(s) 140, 236
Psp124BI GAGCTC 1 cut(s) 156
Psp6I CCWGG 1 cut(s) 74
PspEI GGTNACC 1 cut(s) 70
PspGI CCWGG 1 cut(s) 74
PspPI GGNCC 1 cut(s) 111
SacI GAGCTC 1 cut(s) 156
SaqAI TTAA 2 cut(s) 96, 261
Sau96I GGNCC 1 cut(s) 111
ScrFI CCNGG 2 cut(s) 76, 120
SduI GDGCHC 1 cut(s) 156
SetI ASST 5 cut(s) 27, 84, 92, 110, 156
Sse9I AATT 2 cut(s) 170, 258
SsiI CCGC 1 cut(s) 162
SspMI CTAG 1 cut(s) 132
SstI GAGCTC 1 cut(s) 156
StyD4I CCNGG 2 cut(s) 74, 118
TasI AATT 2 cut(s) 170, 258
TfiI GAWTC 1 cut(s) 190
Tru1I TTAA 2 cut(s) 96, 261
Tru9I TTAA 2 cut(s) 96, 261
TseFI GTSAC 1 cut(s) 70
Tsp45I GTSAC 1 cut(s) 70
TspDTI ATGAA 3 cut(s) 48, 182, 236
XapI RAATTY 1 cut(s) 170
XceI RCATGY 2 cut(s) 144, 240
XspI CTAG 1 cut(s) 132
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.