RchiOBHm_Chr2g0093581

Mitochondrial protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
6856945 .. 6857941
997 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 492 bp
ATGTTCACATTCAATAATAGAGGCATCTATATCATTCTTCTCATTTATGTGGATGACATATTGATCACGGGTAACAACTCTTCTCACATATCACACCTCATTCATAATCTCAACTCCTTATTTTCTATGAAAGATTTGGGCTCTGTTCATTACTTTCTTGGTATTGTGGCTGTTTATAATGGTGATCATTTGCATCTGACACAACACAAATATATTGTGGATTTGTTGAAAAAGACCAAGCTCCATGATTCTAGACCTTATCCTACGCCTGTTTTATCTGGAAAAAAGCTTAGTGTCTATGATGGTGTCCAGTTAGAGGATCTTTCTGAATATCGAAGTATTGTTGAGGCTTTACAGTACCTCACTCTCACTCGTCCTAATATTTGCTATGCTGTCAATCAAGTGTGTCAATTCATGCACTCACCGACTAATGTTCATTGGGTGGCAGTCAAGACTCAAGAGAATCCTACGATATTTGAAGTGTACCCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

163

Amino Acids

18.73

Weight (kDa)

6.78

Isoelectric Point (pI)

34.12

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_2 PF07727 11 - 92 2e-15 Reverse transcriptase (RNA-dependent DNA polymerase)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 177
AclWI GGATC 1 cut(s) 327
AfaI GTAC 2 cut(s) 359, 485
AfiI CCNNNNNNNGG 1 cut(s) 316
AgsI TTSAA 3 cut(s) 13, 229, 479
AluBI AGCT 2 cut(s) 241, 289
AluI AGCT 2 cut(s) 241, 289
AlwI GGATC 1 cut(s) 327
AsuHPI GGTGA 2 cut(s) 194, 414
BanII GRGCYC 1 cut(s) 143
BarI GAAGNNNNNNTAC 2 cut(s) 64, 96
BccI CCATC 1 cut(s) 296
BclI TGATCA 2 cut(s) 63, 184
BfaI CTAG 1 cut(s) 252
BmsI GCATC 2 cut(s) 33, 202
BpuEI CTTGAG 1 cut(s) 441
Bsc4I CCNNNNNNNGG 1 cut(s) 316
Bse1I ACTGG 1 cut(s) 310
BseGI GGATG 1 cut(s) 58
BseLI CCNNNNNNNGG 1 cut(s) 316
BseNI ACTGG 1 cut(s) 310
BslI CCNNNNNNNGG 1 cut(s) 316
Bsp1286I GDGCHC 1 cut(s) 143
Bsp143I GATC 3 cut(s) 63, 184, 319
BspPI GGATC 1 cut(s) 327
BsrI ACTGG 1 cut(s) 310
BssMI GATC 3 cut(s) 63, 184, 319
Bst4CI ACNGT 1 cut(s) 357
Bst6I CTCTTC 1 cut(s) 85
BstDEI CTNAG 1 cut(s) 290
BstF5I GGATG 1 cut(s) 58
BstKTI GATC 3 cut(s) 66, 187, 322
BstMBI GATC 3 cut(s) 63, 184, 319
BstX2I RGATCY 1 cut(s) 319
BstYI RGATCY 1 cut(s) 319
BtsCI GGATG 1 cut(s) 58
Csp6I GTAC 2 cut(s) 358, 484
CviAII CATG 2 cut(s) 245, 415
CviJI RGCY 5 cut(s) 141, 170, 241, 289, 350
CviKI_1 RGCY 5 cut(s) 141, 170, 241, 289, 350
CviQI GTAC 2 cut(s) 358, 484
DdeI CTNAG 1 cut(s) 290
DpnI GATC 3 cut(s) 65, 186, 321
DpnII GATC 3 cut(s) 63, 184, 319
Eam1104I CTCTTC 1 cut(s) 85
EarI CTCTTC 1 cut(s) 85
Eco24I GRGCYC 1 cut(s) 143
EcoT38I GRGCYC 1 cut(s) 143
FaeI CATG 2 cut(s) 248, 418
FatI CATG 2 cut(s) 244, 414
FbaI TGATCA 2 cut(s) 63, 184
FokI GGATG 1 cut(s) 65
FriOI GRGCYC 1 cut(s) 143
FspBI CTAG 1 cut(s) 252
Hin1II CATG 2 cut(s) 248, 418
HindIII AAGCTT 1 cut(s) 287
HinfI GANTC 3 cut(s) 248, 454, 463
HphI GGTGA 2 cut(s) 194, 414
Hpy166II GTNNAC 2 cut(s) 6, 484
Hpy188I TCNGA 2 cut(s) 198, 328
Hpy188III TCNNGA 4 cut(s) 252, 279, 451, 458
Hpy8I GTNNAC 2 cut(s) 6, 484
HpyCH4III ACNGT 1 cut(s) 357
HpyCH4V TGCA 2 cut(s) 193, 418
HpyF3I CTNAG 1 cut(s) 290
Hsp92II CATG 2 cut(s) 248, 418
Ksp22I TGATCA 2 cut(s) 63, 184
Kzo9I GATC 3 cut(s) 63, 184, 319
LmnI GCTCC 1 cut(s) 246
LpnPI CCDG 3 cut(s) 264, 282, 323
LweI GCATC 2 cut(s) 33, 202
MaeI CTAG 1 cut(s) 252
MaeIII GTNAC 1 cut(s) 71
MalI GATC 3 cut(s) 65, 186, 321
MboI GATC 3 cut(s) 63, 184, 319
MboII GAAGA 2 cut(s) 29, 72
MflI RGATCY 1 cut(s) 319
MhlI GDGCHC 1 cut(s) 143
MluCI AATT 1 cut(s) 410
MlyI GAGTC 1 cut(s) 448
MnlI CCTC 5 cut(s) 14, 107, 310, 340, 371
MseI TTAA 1 cut(s) 490
MslI CAYNNNNRTG 1 cut(s) 47
NdeII GATC 3 cut(s) 63, 184, 319
NlaIII CATG 2 cut(s) 248, 418
PfeI GAWTC 2 cut(s) 248, 463
PleI GAGTC 1 cut(s) 448
PpsI GAGTC 1 cut(s) 448
PsiI TTATAA 1 cut(s) 177
PsuI RGATCY 1 cut(s) 319
RsaI GTAC 2 cut(s) 359, 485
RsaNI GTAC 2 cut(s) 358, 484
RseI CAYNNNNRTG 1 cut(s) 47
SaqAI TTAA 1 cut(s) 490
Sau3AI GATC 3 cut(s) 63, 184, 319
SchI GAGTC 1 cut(s) 448
SduI GDGCHC 1 cut(s) 143
SetI ASST 5 cut(s) 99, 243, 259, 291, 363
SfaNI GCATC 2 cut(s) 33, 202
SmiMI CAYNNNNRTG 1 cut(s) 47
SmlI CTYRAG 1 cut(s) 456
SmoI CTYRAG 1 cut(s) 456
Sse9I AATT 1 cut(s) 410
SspI AATATT 1 cut(s) 382
SspMI CTAG 1 cut(s) 252
TaaI ACNGT 1 cut(s) 357
TaqI TCGA 1 cut(s) 334
TasI AATT 1 cut(s) 410
TfiI GAWTC 2 cut(s) 248, 463
Tru1I TTAA 1 cut(s) 490
Tru9I TTAA 1 cut(s) 490
TspDTI ATGAA 5 cut(s) 92, 137, 143, 403, 425
XbaI TCTAGA 1 cut(s) 251
XspI CTAG 1 cut(s) 252
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.