RchiOBHm_Chr2g0125761

pre-rRNA-processing protein TSR2 homolog

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
39617595 .. 39620015
2421 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 291 bp
ATGATTATGCATGAGGAATGTTCGGATTGCAATTTCAAGTCTATTGAAAGCCTAAGGGAAGCCAATAGTCGAAGAGTTCCTACTCCTCATGTTAAACAGGTTGTGGACGATGACGAAGACAGTGATGAGAACGATGATGATACTGATCCTAGCATGAATAAAGATGAGTCATCTAACATGATTGTGGACAAACCAGAGGCTCATGCAGTAGAGCCAAAGACCAAGCAGGCAGTTGAAGCAGAAGATGGTTGGGAGGTAGTCGGACCAAGAAGTAGGGGTAAAAGGAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

96

Amino Acids

10.86

Weight (kDa)

4.5

Isoelectric Point (pI)

62.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 140
AgsI TTSAA 3 cut(s) 37, 47, 236
AlwI GGATC 1 cut(s) 140
AspS9I GGNCC 1 cut(s) 263
AvaII GGWCC 1 cut(s) 263
AxyI CCTNAGG 1 cut(s) 53
BarI GAAGNNNNNNTAC 2 cut(s) 64, 96
BbsI GAAGAC 1 cut(s) 123
BccI CCATC 1 cut(s) 239
BfaI CTAG 1 cut(s) 150
Bme18I GGWCC 1 cut(s) 263
BmgT120I GGNCC 1 cut(s) 263
BpiI GAAGAC 1 cut(s) 123
BsaBI GATNNNNATC 1 cut(s) 144
Bse21I CCTNAGG 1 cut(s) 53
Bse8I GATNNNNATC 1 cut(s) 144
BseJI GATNNNNATC 1 cut(s) 144
BseRI GAGGAG 1 cut(s) 75
Bsp143I GATC 1 cut(s) 145
BspPI GGATC 1 cut(s) 140
BssMI GATC 1 cut(s) 145
Bst4CI ACNGT 1 cut(s) 122
Bst6I CTCTTC 1 cut(s) 67
BstC8I GCNNGC 1 cut(s) 228
BstDEI CTNAG 1 cut(s) 53
BstKTI GATC 1 cut(s) 148
BstMBI GATC 1 cut(s) 145
BstMWI GCNNNNNNNGC 1 cut(s) 236
BstV2I GAAGAC 1 cut(s) 123
Bsu36I CCTNAGG 1 cut(s) 53
BtsIMutI CAGTG 1 cut(s) 127
Cac8I GCNNGC 1 cut(s) 228
Cfr13I GGNCC 1 cut(s) 263
CviAII CATG 5 cut(s) 11, 89, 154, 178, 203
CviJI RGCY 4 cut(s) 51, 62, 200, 214
CviKI_1 RGCY 4 cut(s) 51, 62, 200, 214
DdeI CTNAG 1 cut(s) 53
DpnI GATC 1 cut(s) 147
DpnII GATC 1 cut(s) 145
Eam1104I CTCTTC 1 cut(s) 67
EarI CTCTTC 1 cut(s) 67
Eco47I GGWCC 1 cut(s) 263
Eco81I CCTNAGG 1 cut(s) 53
EcoT22I ATGCAT 1 cut(s) 12
FaeI CATG 5 cut(s) 14, 92, 157, 181, 206
FaiI YATR 6 cut(s) 8, 12, 90, 155, 179, 204
FatI CATG 5 cut(s) 10, 88, 153, 177, 202
FspBI CTAG 1 cut(s) 150
Hin1II CATG 5 cut(s) 14, 92, 157, 181, 206
HinfI GANTC 1 cut(s) 167
Hpy166II GTNNAC 2 cut(s) 106, 187
Hpy188I TCNGA 2 cut(s) 25, 263
Hpy8I GTNNAC 2 cut(s) 106, 187
HpyCH4III ACNGT 1 cut(s) 122
HpyCH4V TGCA 3 cut(s) 10, 30, 206
HpyF10VI GCNNNNNNNGC 1 cut(s) 236
HpyF3I CTNAG 1 cut(s) 53
Hsp92II CATG 5 cut(s) 14, 92, 157, 181, 206
Kzo9I GATC 1 cut(s) 145
LpnPI CCDG 3 cut(s) 83, 207, 212
MaeI CTAG 1 cut(s) 150
MalI GATC 1 cut(s) 147
MboI GATC 1 cut(s) 145
MboII GAAGA 3 cut(s) 84, 128, 254
MluCI AATT 2 cut(s) 31, 286
MlyI GAGTC 1 cut(s) 176
MmeI TCCRAC 1 cut(s) 241
MnlI CCTC 4 cut(s) 7, 96, 190, 247
Mph1103I ATGCAT 1 cut(s) 12
MseI TTAA 2 cut(s) 93, 289
MslI CAYNNNNRTG 1 cut(s) 182
MwoI GCNNNNNNNGC 1 cut(s) 236
NdeII GATC 1 cut(s) 145
NlaIII CATG 5 cut(s) 14, 92, 157, 181, 206
NsiI ATGCAT 1 cut(s) 12
PleI GAGTC 1 cut(s) 175
PpsI GAGTC 1 cut(s) 175
PspPI GGNCC 1 cut(s) 263
RseI CAYNNNNRTG 1 cut(s) 182
SaqAI TTAA 2 cut(s) 93, 289
Sau3AI GATC 1 cut(s) 145
Sau96I GGNCC 1 cut(s) 263
SchI GAGTC 1 cut(s) 176
SetI ASST 2 cut(s) 102, 258
SinI GGWCC 1 cut(s) 263
SmiMI CAYNNNNRTG 1 cut(s) 182
Sse9I AATT 2 cut(s) 31, 286
SspMI CTAG 1 cut(s) 150
TaaI ACNGT 1 cut(s) 122
TaqI TCGA 1 cut(s) 70
TasI AATT 2 cut(s) 31, 286
Tru1I TTAA 2 cut(s) 93, 289
Tru9I TTAA 2 cut(s) 93, 289
TscAI CASTG 1 cut(s) 127
TspDTI ATGAA 1 cut(s) 170
TspRI CASTG 1 cut(s) 127
VpaK11BI GGWCC 1 cut(s) 263
XspI CTAG 1 cut(s) 150
Zsp2I ATGCAT 1 cut(s) 12
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.