Rh2BG325200

pre-rRNA-processing protein TSR2 homolog

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
OG0000787
Physical Location & Seq
Reverse (-)
39719904 .. 39721026
1123 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG325200.1

Sequence Viewer

Length: 261 bp
ATGATTAGTGTTATAGTTTTGATAGCCATCTGTTCATTCTTTTCAGAACCTCTTTATATAGATGATTTAGAAGAAATACTCATTGAAGCTATGAGTTCTCTCAATACTGTGATAGAGGATGGTAGCATTGAGGAGGTAGCTGAAAAAATAATGATTATGCATGAGGAATGTTCGGATTGCAATTTCAAGTCTATTGAAAGCCTAAGGGAAGCCAATAGTCGAAGAGTTCCTACTCCTCATGTTAAACAGGAGAGTGCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
WGG

Protein Analysis

86

Amino Acids

9.69

Weight (kDa)

4.32

Isoelectric Point (pI)

88.06

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
WGG PF10273 9 - 48 1.3e-06 Pre-rRNA-processing protein TSR2
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 3 cut(s) 86, 187, 197
AluBI AGCT 2 cut(s) 89, 140
AluI AGCT 2 cut(s) 89, 140
AxyI CCTNAGG 1 cut(s) 203
BarI GAAGNNNNNNTAC 2 cut(s) 214, 246
BccI CCATC 2 cut(s) 35, 113
BsaBI GATNNNNATC 1 cut(s) 26
Bse21I CCTNAGG 1 cut(s) 203
Bse8I GATNNNNATC 1 cut(s) 26
BseGI GGATG 1 cut(s) 124
BseJI GATNNNNATC 1 cut(s) 26
BseRI GAGGAG 2 cut(s) 146, 225
Bst4CI ACNGT 1 cut(s) 109
Bst6I CTCTTC 1 cut(s) 217
BstDEI CTNAG 1 cut(s) 203
BstF5I GGATG 1 cut(s) 124
Bsu36I CCTNAGG 1 cut(s) 203
BtsCI GGATG 1 cut(s) 124
CviAII CATG 2 cut(s) 161, 239
CviJI RGCY 5 cut(s) 26, 89, 140, 201, 212
CviKI_1 RGCY 5 cut(s) 26, 89, 140, 201, 212
DdeI CTNAG 1 cut(s) 203
Eam1104I CTCTTC 1 cut(s) 217
EarI CTCTTC 1 cut(s) 217
Eco81I CCTNAGG 1 cut(s) 203
EcoT22I ATGCAT 1 cut(s) 162
FaeI CATG 2 cut(s) 164, 242
FaiI YATR 8 cut(s) 14, 57, 59, 92, 158, 162, 240, 259
FatI CATG 2 cut(s) 160, 238
FokI GGATG 1 cut(s) 131
Hin1II CATG 2 cut(s) 164, 242
Hpy188I TCNGA 2 cut(s) 46, 175
HpyCH4III ACNGT 1 cut(s) 109
HpyCH4V TGCA 3 cut(s) 160, 180, 257
HpyF3I CTNAG 1 cut(s) 203
Hsp92II CATG 2 cut(s) 164, 242
LpnPI CCDG 1 cut(s) 233
MboII GAAGA 2 cut(s) 83, 234
MluCI AATT 1 cut(s) 181
MnlI CCTC 6 cut(s) 60, 109, 124, 127, 157, 246
Mph1103I ATGCAT 1 cut(s) 162
MseI TTAA 1 cut(s) 243
NlaIII CATG 2 cut(s) 164, 242
NsiI ATGCAT 1 cut(s) 162
SaqAI TTAA 1 cut(s) 243
SetI ASST 4 cut(s) 52, 91, 138, 142
SgeI CNNG 3 cut(s) 173, 199, 251
Sse9I AATT 1 cut(s) 181
TaaI ACNGT 1 cut(s) 109
TaqI TCGA 1 cut(s) 220
TasI AATT 1 cut(s) 181
Tru1I TTAA 1 cut(s) 243
Tru9I TTAA 1 cut(s) 243
TspDTI ATGAA 1 cut(s) 24
Zsp2I ATGCAT 1 cut(s) 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.