Rw2G025660

pre-rRNA-processing protein TSR2 homolog

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr2
Physical Location & Seq
Reverse (-)
38636487 .. 38638316
1830 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw2G025660.1

Sequence Viewer

Length: 438 bp
ATGATTTGTCAATTTTGTGCTGAAATATGGTTCAGCAATACGAAACCTCTTTATATAGATGATTTAGAAGAAATGCTCATTGAAGCTATGAGTTCTCTCAATACTGTGATAGAGGATGGTAGCATTGAGGAGGTAGCTGAAAAAATAATGATTATGCATGAGGAATGTTCGGATTGCAATTTCAAGTCTATTGAAAGCATAAGGGAAGCCAATAGTCGAAGAGTTCCTACTCCTCATGTTAAACAGGTTGTGGATGATGACGAAGACAGTGATGAGAACGATGATGATACTGATCCTAGCGTGAATAAAGATGAGTCATCTAACATGATTGTGGACAAACCAGAGGCTCATGCAGTAGAGCCAAAGACCAAGCAGGCAGTTGAAGCAGAAGATGGTTGGGAGGTAGTCGGACCAAGAAGTAGGGGTAAAAGGAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

145

Amino Acids

16.42

Weight (kDa)

4.28

Isoelectric Point (pI)

60.66

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
WGG PF10273 10 - 47 5.1e-07 Pre-rRNA-processing protein TSR2
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 287
AgsI TTSAA 4 cut(s) 83, 184, 194, 383
AluBI AGCT 2 cut(s) 86, 137
AluI AGCT 2 cut(s) 86, 137
AlwI GGATC 1 cut(s) 287
AspS9I GGNCC 1 cut(s) 410
AvaII GGWCC 1 cut(s) 410
BarI GAAGNNNNNNTAC 2 cut(s) 211, 243
BbsI GAAGAC 1 cut(s) 270
BccI CCATC 2 cut(s) 110, 386
BfaI CTAG 1 cut(s) 297
Bme18I GGWCC 1 cut(s) 410
BmgT120I GGNCC 1 cut(s) 410
BpiI GAAGAC 1 cut(s) 270
BsaBI GATNNNNATC 1 cut(s) 291
Bse8I GATNNNNATC 1 cut(s) 291
BseGI GGATG 2 cut(s) 121, 259
BseJI GATNNNNATC 1 cut(s) 291
BseRI GAGGAG 2 cut(s) 143, 222
Bsp143I GATC 1 cut(s) 292
BspPI GGATC 1 cut(s) 287
BssMI GATC 1 cut(s) 292
Bst4CI ACNGT 2 cut(s) 106, 269
Bst6I CTCTTC 1 cut(s) 214
BstC8I GCNNGC 1 cut(s) 375
BstF5I GGATG 2 cut(s) 121, 259
BstKTI GATC 1 cut(s) 295
BstMBI GATC 1 cut(s) 292
BstMWI GCNNNNNNNGC 1 cut(s) 383
BstV2I GAAGAC 1 cut(s) 270
BtsCI GGATG 2 cut(s) 121, 259
BtsIMutI CAGTG 1 cut(s) 274
Cac8I GCNNGC 1 cut(s) 375
Cfr13I GGNCC 1 cut(s) 410
CviAII CATG 4 cut(s) 158, 236, 325, 350
CviJI RGCY 5 cut(s) 86, 137, 209, 347, 361
CviKI_1 RGCY 5 cut(s) 86, 137, 209, 347, 361
DpnI GATC 1 cut(s) 294
DpnII GATC 1 cut(s) 292
Eam1104I CTCTTC 1 cut(s) 214
EarI CTCTTC 1 cut(s) 214
Eco47I GGWCC 1 cut(s) 410
EcoT22I ATGCAT 1 cut(s) 159
FaeI CATG 4 cut(s) 161, 239, 328, 353
FatI CATG 4 cut(s) 157, 235, 324, 349
FokI GGATG 2 cut(s) 128, 266
FspBI CTAG 1 cut(s) 297
Hin1II CATG 4 cut(s) 161, 239, 328, 353
HinfI GANTC 1 cut(s) 314
Hpy166II GTNNAC 1 cut(s) 334
Hpy188I TCNGA 2 cut(s) 172, 410
Hpy8I GTNNAC 1 cut(s) 334
HpyCH4III ACNGT 2 cut(s) 106, 269
HpyCH4V TGCA 3 cut(s) 157, 177, 353
HpyF10VI GCNNNNNNNGC 1 cut(s) 383
Hsp92II CATG 4 cut(s) 161, 239, 328, 353
Kzo9I GATC 1 cut(s) 292
LpnPI CCDG 3 cut(s) 230, 354, 359
MaeI CTAG 1 cut(s) 297
MalI GATC 1 cut(s) 294
MboI GATC 1 cut(s) 292
MboII GAAGA 4 cut(s) 80, 231, 275, 401
MluCI AATT 3 cut(s) 11, 178, 433
MlyI GAGTC 1 cut(s) 323
MmeI TCCRAC 1 cut(s) 388
MnlI CCTC 8 cut(s) 57, 106, 121, 124, 154, 243, 337, 394
Mph1103I ATGCAT 1 cut(s) 159
MseI TTAA 2 cut(s) 240, 436
MslI CAYNNNNRTG 1 cut(s) 329
MwoI GCNNNNNNNGC 1 cut(s) 383
NdeII GATC 1 cut(s) 292
NlaIII CATG 4 cut(s) 161, 239, 328, 353
NsiI ATGCAT 1 cut(s) 159
PleI GAGTC 1 cut(s) 322
PpsI GAGTC 1 cut(s) 322
PspPI GGNCC 1 cut(s) 410
RseI CAYNNNNRTG 1 cut(s) 329
SaqAI TTAA 2 cut(s) 240, 436
Sau3AI GATC 1 cut(s) 292
Sau96I GGNCC 1 cut(s) 410
SchI GAGTC 1 cut(s) 323
SetI ASST 6 cut(s) 49, 88, 135, 139, 249, 405
SinI GGWCC 1 cut(s) 410
SmiMI CAYNNNNRTG 1 cut(s) 329
Sse9I AATT 3 cut(s) 11, 178, 433
SspMI CTAG 1 cut(s) 297
TaaI ACNGT 2 cut(s) 106, 269
TaqI TCGA 1 cut(s) 217
TasI AATT 3 cut(s) 11, 178, 433
Tru1I TTAA 2 cut(s) 240, 436
Tru9I TTAA 2 cut(s) 240, 436
TscAI CASTG 1 cut(s) 274
TspRI CASTG 1 cut(s) 274
VpaK11BI GGWCC 1 cut(s) 410
XspI CTAG 1 cut(s) 297
Zsp2I ATGCAT 1 cut(s) 159
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.