Rh5AG009900

pre-rRNA-processing protein TSR2 homolog

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
OG0000787
Physical Location & Seq
Forward (+)
694683 .. 695130
448 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG009900.1

Sequence Viewer

Length: 183 bp
ATGACATCCTCATGGCCGACTGCGACTGTGTTCCAAGAATGGGTCCGATTAGTTCTATTGCGGTGGTCGACGCTTCAATTGGTCGTCGAGAACGAGTGGGGTAGCCGTGACTCGAGCCTCAAGACCGAGCAACTCGTCTCCGATGTCGTCTCCTGGGTCAATCACTCCACCGATAAGCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
WGG

Protein Analysis

60

Amino Acids

6.98

Weight (kDa)

5.05

Isoelectric Point (pI)

36.2

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
WGG PF10273 11 - 56 1.6e-11 Pre-rRNA-processing protein TSR2
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 68
AciI CCGC 1 cut(s) 61
AcoI YGGCCR 1 cut(s) 14
AfiI CCNNNNNNNGG 1 cut(s) 40
AgsI TTSAA 1 cut(s) 77
AjnI CCWGG 1 cut(s) 152
AluBI AGCT 1 cut(s) 178
AluI AGCT 1 cut(s) 178
Alw26I GTCTC 2 cut(s) 142, 154
Ama87I CYCGRG 1 cut(s) 112
AoxI GGCC 1 cut(s) 14
AspS9I GGNCC 1 cut(s) 43
AvaI CYCGRG 1 cut(s) 112
AvaII GGWCC 1 cut(s) 43
BceAI ACGGC 1 cut(s) 90
BciT130I CCWGG 1 cut(s) 154
BcoDI GTCTC 2 cut(s) 142, 154
Bme1390I CCNGG 1 cut(s) 154
Bme18I GGWCC 1 cut(s) 43
BmeT110I CYCGRG 1 cut(s) 112
BmgT120I GGNCC 1 cut(s) 43
BmiI GGNNCC 1 cut(s) 44
BmrFI CCNGG 1 cut(s) 154
BpuEI CTTGAG 1 cut(s) 104
BsaJI CCNNGG 1 cut(s) 153
Bsc4I CCNNNNNNNGG 1 cut(s) 40
BseBI CCWGG 1 cut(s) 154
BseDI CCNNGG 1 cut(s) 153
BseGI GGATG 1 cut(s) 5
BseLI CCNNNNNNNGG 1 cut(s) 40
BshFI GGCC 1 cut(s) 16
BsiHKCI CYCGRG 1 cut(s) 112
BslI CCNNNNNNNGG 1 cut(s) 40
BsmAI GTCTC 2 cut(s) 142, 154
BsmBI CGTCTC 2 cut(s) 142, 154
BsnI GGCC 1 cut(s) 16
BsoBI CYCGRG 1 cut(s) 112
BspACI CCGC 1 cut(s) 61
BspANI GGCC 1 cut(s) 16
BspLI GGNNCC 1 cut(s) 44
BssECI CCNNGG 1 cut(s) 153
Bst2UI CCWGG 1 cut(s) 154
Bst4CI ACNGT 1 cut(s) 28
BstF5I GGATG 1 cut(s) 5
BstMAI GTCTC 2 cut(s) 142, 154
BstNI CCWGG 1 cut(s) 154
BstSCI CCNGG 1 cut(s) 152
BsuRI GGCC 1 cut(s) 16
BtsCI GGATG 1 cut(s) 5
Cfr13I GGNCC 1 cut(s) 43
CseI GACGC 1 cut(s) 79
CviAII CATG 1 cut(s) 12
CviJI RGCY 4 cut(s) 16, 105, 117, 178
CviKI_1 RGCY 4 cut(s) 16, 105, 117, 178
EaeI YGGCCR 1 cut(s) 14
Eco47I GGWCC 1 cut(s) 43
Eco88I CYCGRG 1 cut(s) 112
EcoRII CCWGG 1 cut(s) 152
Esp3I CGTCTC 2 cut(s) 142, 154
FaeI CATG 1 cut(s) 15
FaiI YATR 1 cut(s) 13
FatI CATG 1 cut(s) 11
FblI GTMKAC 1 cut(s) 68
HaeIII GGCC 1 cut(s) 16
HgaI GACGC 1 cut(s) 79
Hin1II CATG 1 cut(s) 15
HincII GTYRAC 1 cut(s) 69
HindII GTYRAC 1 cut(s) 69
HindIII AAGCTT 1 cut(s) 176
HinfI GANTC 1 cut(s) 110
Hpy166II GTNNAC 1 cut(s) 69
Hpy188I TCNGA 2 cut(s) 47, 142
Hpy188III TCNNGA 2 cut(s) 88, 121
Hpy8I GTNNAC 1 cut(s) 69
Hpy99I CGWCG 2 cut(s) 73, 89
HpyCH4III ACNGT 1 cut(s) 28
Hsp92II CATG 1 cut(s) 15
LpnPI CCDG 2 cut(s) 139, 166
MaeIII GTNAC 1 cut(s) 107
MfeI CAATTG 1 cut(s) 77
MluCI AATT 1 cut(s) 77
MlyI GAGTC 1 cut(s) 104
MnlI CCTC 2 cut(s) 19, 128
MseI TTAA 1 cut(s) 181
MslI CAYNNNNRTG 1 cut(s) 10
MspR9I CCNGG 1 cut(s) 154
MunI CAATTG 1 cut(s) 77
MvaI CCWGG 1 cut(s) 154
NlaIII CATG 1 cut(s) 15
NlaIV GGNNCC 1 cut(s) 44
NmuCI GTSAC 1 cut(s) 107
PaeR7I CTCGAG 1 cut(s) 112
PcsI WCGNNNNNNNCGW 1 cut(s) 90
PleI GAGTC 1 cut(s) 104
PpsI GAGTC 1 cut(s) 104
Psp6I CCWGG 1 cut(s) 152
PspGI CCWGG 1 cut(s) 152
PspN4I GGNNCC 1 cut(s) 44
PspPI GGNCC 1 cut(s) 43
PspXI VCTCGAGB 1 cut(s) 112
RseI CAYNNNNRTG 1 cut(s) 10
SalI GTCGAC 1 cut(s) 67
SaqAI TTAA 1 cut(s) 181
Sau96I GGNCC 1 cut(s) 43
SchI GAGTC 1 cut(s) 104
ScrFI CCNGG 1 cut(s) 154
SetI ASST 1 cut(s) 180
Sfr274I CTCGAG 1 cut(s) 112
SinI GGWCC 1 cut(s) 43
SlaI CTCGAG 1 cut(s) 112
SmiMI CAYNNNNRTG 1 cut(s) 10
SmlI CTYRAG 2 cut(s) 112, 119
SmoI CTYRAG 2 cut(s) 112, 119
Sse9I AATT 1 cut(s) 77
SsiI CCGC 1 cut(s) 61
StyD4I CCNGG 1 cut(s) 152
TaaI ACNGT 1 cut(s) 28
TaqI TCGA 3 cut(s) 68, 87, 113
TaqII GACCGA 1 cut(s) 140
TasI AATT 1 cut(s) 77
Tru1I TTAA 1 cut(s) 181
Tru9I TTAA 1 cut(s) 181
TseFI GTSAC 1 cut(s) 107
Tsp45I GTSAC 1 cut(s) 107
VpaK11BI GGWCC 1 cut(s) 43
XhoI CTCGAG 1 cut(s) 112
XmiI GTMKAC 1 cut(s) 68
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.