Rh2CG307000

pre-rRNA-processing protein TSR2 homolog

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Reverse (-)
36824100 .. 36834582
10483 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG307000.1

Sequence Viewer

Length: 390 bp
ATGATTAGTGTTATAGTTTTGATAGCCATCTGTTCATTCTTTTCAGAACCTCTTTATATAGATGATTTAGAAGAAATGCTCATTGAAGCTATGAGTTCTCTCAATACTGTGATAGAGGATGGTAGCATTGAGGAGGTAGCTGAAAAAATAATGATTATGCATGAGGAATGTTCGGATTGCAATTTCAAGTCTATTGAAAGCCTAAGGGAAGCCAATAGTCGAAGAGTTCCTACTCCTCATGTTAAACAGGTTGTGGATGATGACGAAGACAGTGATGAGAACGATGATGACACTGATCCTAGCATGAATAAAGATGAGTCATCTAACATGATTGTGGACAAACCAGAGGCTCATGCATGCAGTAGAGCCAAAGACCAAGCAGGCAGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

129

Amino Acids

14.4

Weight (kDa)

4.09

Isoelectric Point (pI)

64.98

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
WGG PF10273 9 - 48 2.5e-06 Pre-rRNA-processing protein TSR2
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 290
AgsI TTSAA 3 cut(s) 86, 187, 197
AluBI AGCT 2 cut(s) 89, 140
AluI AGCT 2 cut(s) 89, 140
AlwI GGATC 1 cut(s) 290
AxyI CCTNAGG 1 cut(s) 203
BarI GAAGNNNNNNTAC 2 cut(s) 214, 246
BbsI GAAGAC 1 cut(s) 273
BccI CCATC 2 cut(s) 35, 113
BfaI CTAG 1 cut(s) 300
BpiI GAAGAC 1 cut(s) 273
BsaBI GATNNNNATC 1 cut(s) 26
Bse21I CCTNAGG 1 cut(s) 203
Bse8I GATNNNNATC 1 cut(s) 26
BseGI GGATG 2 cut(s) 124, 262
BseJI GATNNNNATC 1 cut(s) 26
BseRI GAGGAG 2 cut(s) 146, 225
Bsp143I GATC 1 cut(s) 295
BspPI GGATC 1 cut(s) 290
BssMI GATC 1 cut(s) 295
Bst4CI ACNGT 2 cut(s) 109, 272
Bst6I CTCTTC 1 cut(s) 217
BstC8I GCNNGC 2 cut(s) 358, 382
BstDEI CTNAG 1 cut(s) 203
BstF5I GGATG 2 cut(s) 124, 262
BstKTI GATC 1 cut(s) 298
BstMBI GATC 1 cut(s) 295
BstNSI RCATGY 1 cut(s) 360
BstV2I GAAGAC 1 cut(s) 273
Bsu36I CCTNAGG 1 cut(s) 203
BtsCI GGATG 2 cut(s) 124, 262
BtsIMutI CAGTG 2 cut(s) 277, 291
Cac8I GCNNGC 2 cut(s) 358, 382
CviAII CATG 6 cut(s) 161, 239, 304, 328, 353, 357
CviJI RGCY 7 cut(s) 26, 89, 140, 201, 212, 350, 368
CviKI_1 RGCY 7 cut(s) 26, 89, 140, 201, 212, 350, 368
DdeI CTNAG 1 cut(s) 203
DpnI GATC 1 cut(s) 297
DpnII GATC 1 cut(s) 295
Eam1104I CTCTTC 1 cut(s) 217
EarI CTCTTC 1 cut(s) 217
Eco81I CCTNAGG 1 cut(s) 203
EcoT22I ATGCAT 2 cut(s) 162, 358
FaeI CATG 6 cut(s) 164, 242, 307, 331, 356, 360
FatI CATG 6 cut(s) 160, 238, 303, 327, 352, 356
FokI GGATG 2 cut(s) 131, 269
FspBI CTAG 1 cut(s) 300
Hin1II CATG 6 cut(s) 164, 242, 307, 331, 356, 360
HinfI GANTC 1 cut(s) 317
Hpy166II GTNNAC 1 cut(s) 337
Hpy188I TCNGA 2 cut(s) 46, 175
Hpy8I GTNNAC 1 cut(s) 337
HpyCH4III ACNGT 2 cut(s) 109, 272
HpyCH4V TGCA 4 cut(s) 160, 180, 356, 360
HpyF3I CTNAG 1 cut(s) 203
Hsp92II CATG 6 cut(s) 164, 242, 307, 331, 356, 360
Kzo9I GATC 1 cut(s) 295
LpnPI CCDG 3 cut(s) 233, 357, 366
MaeI CTAG 1 cut(s) 300
MalI GATC 1 cut(s) 297
MboI GATC 1 cut(s) 295
MboII GAAGA 3 cut(s) 83, 234, 278
MluCI AATT 1 cut(s) 181
MlyI GAGTC 1 cut(s) 326
MnlI CCTC 7 cut(s) 60, 109, 124, 127, 157, 246, 340
Mph1103I ATGCAT 2 cut(s) 162, 358
MseI TTAA 1 cut(s) 243
MslI CAYNNNNRTG 1 cut(s) 332
NdeII GATC 1 cut(s) 295
NlaIII CATG 6 cut(s) 164, 242, 307, 331, 356, 360
NsiI ATGCAT 2 cut(s) 162, 358
NspI RCATGY 1 cut(s) 360
PaeI GCATGC 1 cut(s) 360
PleI GAGTC 1 cut(s) 325
PpsI GAGTC 1 cut(s) 325
RseI CAYNNNNRTG 1 cut(s) 332
SaqAI TTAA 1 cut(s) 243
Sau3AI GATC 1 cut(s) 295
SchI GAGTC 1 cut(s) 326
SetI ASST 5 cut(s) 52, 91, 138, 142, 252
SmiMI CAYNNNNRTG 1 cut(s) 332
SphI GCATGC 1 cut(s) 360
Sse9I AATT 1 cut(s) 181
SspMI CTAG 1 cut(s) 300
TaaI ACNGT 2 cut(s) 109, 272
TaqI TCGA 1 cut(s) 220
TasI AATT 1 cut(s) 181
Tru1I TTAA 1 cut(s) 243
Tru9I TTAA 1 cut(s) 243
TscAI CASTG 2 cut(s) 277, 298
TspDTI ATGAA 2 cut(s) 24, 320
TspRI CASTG 2 cut(s) 277, 298
XceI RCATGY 1 cut(s) 360
XspI CTAG 1 cut(s) 300
Zsp2I ATGCAT 2 cut(s) 162, 358
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.