Rmu_sc0019244.1_g000002

pre-rRNA-processing protein TSR2 homolog

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0019244.1
OG0000787
Physical Location & Seq
Reverse (-)
4087 .. 4481
395 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0019244.1_g000002.1.cds

Sequence Viewer

Length: 312 bp
atggagcctgagagaaagctaacggcggcggctgtggcggcgttccaagaaggggtcgggctagttctgtcgcggtggtcggcgcttcaattggccgttgagaacgagtggggtggccgtgactcgcgcctcaaggccgagcaactcctctccgatatcgtctcctgggtcaatcactccaccgagccattgtttgtgtttggatttgttgagagtttaatcgagttgttttggcatcaagttcagttctttggttcggaaattgtgcttctgagaatcaatactgaatttgattcaagagaacatgtctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
WGG

Protein Analysis

103

Amino Acids

11.76

Weight (kDa)

4.8

Isoelectric Point (pI)

46.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 73, 127
AciI CCGC 4 cut(s) 26, 29, 38, 73
AcoI YGGCCR 2 cut(s) 93, 115
AcsI RAATTY 1 cut(s) 287
AfiI CCNNNNNNNGG 1 cut(s) 52
AflIII ACRYGT 1 cut(s) 304
AgsI TTSAA 2 cut(s) 89, 297
AjnI CCWGG 1 cut(s) 164
AluBI AGCT 1 cut(s) 19
AluI AGCT 1 cut(s) 19
Alw26I GTCTC 1 cut(s) 166
AoxI GGCC 3 cut(s) 93, 115, 135
ApoI RAATTY 1 cut(s) 287
AspLEI GCGC 2 cut(s) 85, 129
BceAI ACGGC 3 cut(s) 39, 80, 102
BciT130I CCWGG 1 cut(s) 166
BcoDI GTCTC 1 cut(s) 166
BfaI CTAG 1 cut(s) 62
BfoI RGCGCY 1 cut(s) 86
BisI GCNGC 3 cut(s) 27, 30, 39
BlsI GCNGC 3 cut(s) 28, 31, 40
Bme1390I CCNGG 1 cut(s) 166
BmiI GGNNCC 1 cut(s) 6
BmrFI CCNGG 1 cut(s) 166
BmsI GCATC 1 cut(s) 244
BpuEI CTTGAG 1 cut(s) 116
BsaJI CCNNGG 1 cut(s) 165
Bsc4I CCNNNNNNNGG 1 cut(s) 52
BseBI CCWGG 1 cut(s) 166
BseDI CCNNGG 1 cut(s) 165
BseLI CCNNNNNNNGG 1 cut(s) 52
BseMII CTCAG 1 cut(s) 263
BseRI GAGGAG 1 cut(s) 137
Bsh1236I CGCG 2 cut(s) 73, 127
BshFI GGCC 3 cut(s) 95, 117, 137
BslI CCNNNNNNNGG 1 cut(s) 52
BsmAI GTCTC 1 cut(s) 166
BsmBI CGTCTC 1 cut(s) 166
BsnI GGCC 3 cut(s) 95, 117, 137
BspACI CCGC 4 cut(s) 26, 29, 38, 73
BspANI GGCC 3 cut(s) 95, 117, 137
BspCNI CTCAG 1 cut(s) 264
BspFNI CGCG 2 cut(s) 73, 127
BspLI GGNNCC 1 cut(s) 6
BssECI CCNNGG 1 cut(s) 165
Bst2UI CCWGG 1 cut(s) 166
BstDEI CTNAG 2 cut(s) 9, 272
BstFNI CGCG 2 cut(s) 73, 127
BstH2I RGCGCY 1 cut(s) 86
BstHHI GCGC 2 cut(s) 85, 129
BstMAI GTCTC 1 cut(s) 166
BstMWI GCNNNNNNNGC 2 cut(s) 35, 38
BstNI CCWGG 1 cut(s) 166
BstNSI RCATGY 1 cut(s) 308
BstSCI CCNGG 1 cut(s) 164
BstUI CGCG 2 cut(s) 73, 127
BsuRI GGCC 3 cut(s) 95, 117, 137
CfoI GCGC 2 cut(s) 85, 129
CviAII CATG 1 cut(s) 305
CviJI RGCY 8 cut(s) 7, 19, 32, 61, 95, 117, 137, 187
CviKI_1 RGCY 8 cut(s) 7, 19, 32, 61, 95, 117, 137, 187
DdeI CTNAG 2 cut(s) 9, 272
EaeI YGGCCR 2 cut(s) 93, 115
Eco32I GATATC 1 cut(s) 157
EcoRII CCWGG 1 cut(s) 164
EcoRV GATATC 1 cut(s) 157
Esp3I CGTCTC 1 cut(s) 166
FaeI CATG 1 cut(s) 308
FaiI YATR 1 cut(s) 306
FatI CATG 1 cut(s) 304
Fnu4HI GCNGC 3 cut(s) 27, 30, 39
Fsp4HI GCNGC 3 cut(s) 27, 30, 39
FspBI CTAG 1 cut(s) 62
GlaI GCGC 2 cut(s) 84, 128
GluI GCNGC 3 cut(s) 27, 30, 39
HaeII RGCGCY 1 cut(s) 86
HaeIII GGCC 3 cut(s) 95, 117, 137
HhaI GCGC 2 cut(s) 85, 129
Hin1II CATG 1 cut(s) 308
Hin6I GCGC 2 cut(s) 83, 127
HinP1I GCGC 2 cut(s) 83, 127
HinfI GANTC 3 cut(s) 122, 276, 293
Hpy188I TCNGA 3 cut(s) 154, 259, 273
Hpy188III TCNNGA 1 cut(s) 297
HpyAV CCTTC 1 cut(s) 44
HpyF10VI GCNNNNNNNGC 2 cut(s) 35, 38
HpyF3I CTNAG 2 cut(s) 9, 272
Hsp92II CATG 1 cut(s) 308
HspAI GCGC 2 cut(s) 83, 127
LmnI GCTCC 1 cut(s) 4
LpnPI CCDG 3 cut(s) 21, 151, 178
LweI GCATC 1 cut(s) 244
MaeI CTAG 1 cut(s) 62
MaeIII GTNAC 1 cut(s) 119
MfeI CAATTG 1 cut(s) 89
MluCI AATT 3 cut(s) 89, 261, 287
MlyI GAGTC 1 cut(s) 116
MnlI CCTC 2 cut(s) 140, 158
MseI TTAA 1 cut(s) 218
MspR9I CCNGG 1 cut(s) 166
MunI CAATTG 1 cut(s) 89
MvaI CCWGG 1 cut(s) 166
MvnI CGCG 2 cut(s) 73, 127
MwoI GCNNNNNNNGC 2 cut(s) 35, 38
NlaIII CATG 1 cut(s) 308
NlaIV GGNNCC 1 cut(s) 6
NmeAIII GCCGAG 1 cut(s) 163
NmuCI GTSAC 1 cut(s) 119
NspI RCATGY 1 cut(s) 308
PciI ACATGT 1 cut(s) 304
PfeI GAWTC 2 cut(s) 276, 293
PkrI GCNGC 3 cut(s) 28, 31, 40
PleI GAGTC 1 cut(s) 116
PpsI GAGTC 1 cut(s) 116
PscI ACATGT 1 cut(s) 304
Psp6I CCWGG 1 cut(s) 164
PspGI CCWGG 1 cut(s) 164
PspN4I GGNNCC 1 cut(s) 6
SaqAI TTAA 1 cut(s) 218
SatI GCNGC 3 cut(s) 27, 30, 39
SchI GAGTC 1 cut(s) 116
ScrFI CCNGG 1 cut(s) 166
SetI ASST 1 cut(s) 21
SfaNI GCATC 1 cut(s) 244
SmlI CTYRAG 1 cut(s) 131
SmoI CTYRAG 1 cut(s) 131
Sse9I AATT 3 cut(s) 89, 261, 287
SsiI CCGC 4 cut(s) 26, 29, 38, 73
SspMI CTAG 1 cut(s) 62
StyD4I CCNGG 1 cut(s) 164
TaqI TCGA 1 cut(s) 222
TasI AATT 3 cut(s) 89, 261, 287
TauI GCSGC 3 cut(s) 29, 32, 41
TfiI GAWTC 2 cut(s) 276, 293
Tru1I TTAA 1 cut(s) 218
Tru9I TTAA 1 cut(s) 218
TseFI GTSAC 1 cut(s) 119
Tsp45I GTSAC 1 cut(s) 119
XapI RAATTY 1 cut(s) 287
XceI RCATGY 1 cut(s) 308
XspI CTAG 1 cut(s) 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.