RchiOBHm_Chr1g0339881

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0000866
Physical Location & Seq
Forward (+)
31368819 .. 31369453
635 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 246 bp
ATGGCATTCTCAAAGACTTTTCTTCTTGTCGCCCTTGCCTTTGCTGTTCTCCTCATCTCTGCTGAGGTCTCGGCTCATCGTGACCTAGCTGAGGCTGCAGCCACTACTACTCAAAAAGCCAACACTGACGGTTACCATGGACACGATCATGGACATGGCGGCCATGGAGGACATGGAGGACATGGTGGACACGGAGGACATGGAGGACATGGACCTCATGCTGTTGAGACTGAAACTGAGAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

8.18

Weight (kDa)

6.13

Isoelectric Point (pI)

12.75

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GRP PF07172 1 - 71 6.8e-11 Glycine rich protein family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 159
AcoI YGGCCR 1 cut(s) 160
AfiI CCNNNNNNNGG 1 cut(s) 91
AluBI AGCT 1 cut(s) 89
AluI AGCT 1 cut(s) 89
Alw26I GTCTC 2 cut(s) 73, 221
AoxI GGCC 1 cut(s) 160
ApeKI GCWGC 2 cut(s) 95, 98
AspS9I GGNCC 1 cut(s) 212
AvaII GGWCC 1 cut(s) 212
BbvCI CCTCAGC 2 cut(s) 63, 90
BbvI GCAGC 2 cut(s) 82, 110
BcoDI GTCTC 2 cut(s) 73, 221
BfaI CTAG 2 cut(s) 86, 244
BfmI CTRYAG 1 cut(s) 96
BisI GCNGC 3 cut(s) 96, 99, 160
BlsI GCNGC 3 cut(s) 97, 100, 161
Bme18I GGWCC 1 cut(s) 212
BmgT120I GGNCC 1 cut(s) 212
Bpu10I CCTNAGC 2 cut(s) 63, 90
BsaI GGTCTC 1 cut(s) 73
BsaJI CCNNGG 2 cut(s) 136, 163
Bsc4I CCNNNNNNNGG 1 cut(s) 91
BseDI CCNNGG 2 cut(s) 136, 163
BseLI CCNNNNNNNGG 1 cut(s) 91
BseMII CTCAG 3 cut(s) 54, 81, 228
BseRI GAGGAG 1 cut(s) 41
BseXI GCAGC 2 cut(s) 82, 110
BshFI GGCC 1 cut(s) 162
BslI CCNNNNNNNGG 1 cut(s) 91
BsmAI GTCTC 2 cut(s) 73, 221
BsmI GAATGC 1 cut(s) 5
BsnI GGCC 1 cut(s) 162
Bso31I GGTCTC 1 cut(s) 73
Bsp143I GATC 1 cut(s) 145
Bsp19I CCATGG 2 cut(s) 136, 163
BspACI CCGC 1 cut(s) 159
BspANI GGCC 1 cut(s) 162
BspCNI CTCAG 3 cut(s) 55, 82, 229
BspMAI CTGCAG 1 cut(s) 100
BspTNI GGTCTC 1 cut(s) 73
BssECI CCNNGG 2 cut(s) 136, 163
BssMI GATC 1 cut(s) 145
BssT1I CCWWGG 2 cut(s) 136, 163
Bst4CI ACNGT 1 cut(s) 131
BstDEI CTNAG 3 cut(s) 63, 90, 237
BstDSI CCRYGG 2 cut(s) 136, 163
BstEII GGTNACC 1 cut(s) 131
BstENI CCTNNNNNAGG 1 cut(s) 89
BstKTI GATC 1 cut(s) 148
BstMAI GTCTC 2 cut(s) 73, 221
BstMBI GATC 1 cut(s) 145
BstMWI GCNNNNNNNGC 1 cut(s) 95
BstPI GGTNACC 1 cut(s) 131
BstSFI CTRYAG 1 cut(s) 96
BstV1I GCAGC 2 cut(s) 82, 110
BsuRI GGCC 1 cut(s) 162
BtgI CCRYGG 2 cut(s) 136, 163
BtsIMutI CAGTG 1 cut(s) 123
Cfr13I GGNCC 1 cut(s) 212
CviAII CATG 9 cut(s) 137, 149, 155, 164, 173, 182, 200, 209, 218
CviJI RGCY 6 cut(s) 74, 89, 95, 101, 119, 162
CviKI_1 RGCY 6 cut(s) 74, 89, 95, 101, 119, 162
DdeI CTNAG 3 cut(s) 63, 90, 237
DpnI GATC 1 cut(s) 147
DpnII GATC 1 cut(s) 145
EaeI YGGCCR 1 cut(s) 160
Eco130I CCWWGG 2 cut(s) 136, 163
Eco31I GGTCTC 1 cut(s) 73
Eco47I GGWCC 1 cut(s) 212
Eco91I GGTNACC 1 cut(s) 131
EcoNI CCTNNNNNAGG 1 cut(s) 89
EcoO65I GGTNACC 1 cut(s) 131
EcoT14I CCWWGG 2 cut(s) 136, 163
ErhI CCWWGG 2 cut(s) 136, 163
FaeI CATG 9 cut(s) 140, 152, 158, 167, 176, 185, 203, 212, 221
FaiI YATR 9 cut(s) 138, 150, 156, 165, 174, 183, 201, 210, 219
FatI CATG 9 cut(s) 136, 148, 154, 163, 172, 181, 199, 208, 217
Fnu4HI GCNGC 3 cut(s) 96, 99, 160
Fsp4HI GCNGC 3 cut(s) 96, 99, 160
FspBI CTAG 2 cut(s) 86, 244
GluI GCNGC 3 cut(s) 96, 99, 160
HaeIII GGCC 1 cut(s) 162
Hin1II CATG 9 cut(s) 140, 152, 158, 167, 176, 185, 203, 212, 221
Hpy166II GTNNAC 1 cut(s) 188
Hpy188III TCNNGA 1 cut(s) 80
Hpy8I GTNNAC 1 cut(s) 188
HpyCH4III ACNGT 1 cut(s) 131
HpyCH4V TGCA 1 cut(s) 98
HpyF10VI GCNNNNNNNGC 1 cut(s) 95
HpyF3I CTNAG 3 cut(s) 63, 90, 237
Hsp92II CATG 9 cut(s) 140, 152, 158, 167, 176, 185, 203, 212, 221
Kzo9I GATC 1 cut(s) 145
Lsp1109I GCAGC 2 cut(s) 82, 110
MaeI CTAG 2 cut(s) 86, 244
MaeIII GTNAC 2 cut(s) 80, 131
MalI GATC 1 cut(s) 147
MboI GATC 1 cut(s) 145
MboII GAAGA 1 cut(s) 14
MnlI CCTC 8 cut(s) 58, 62, 85, 161, 170, 188, 197, 225
MslI CAYNNNNRTG 2 cut(s) 147, 153
Mva1269I GAATGC 1 cut(s) 5
MwoI GCNNNNNNNGC 1 cut(s) 95
NcoI CCATGG 2 cut(s) 136, 163
NdeII GATC 1 cut(s) 145
NlaIII CATG 9 cut(s) 140, 152, 158, 167, 176, 185, 203, 212, 221
NmeAIII GCCGAG 1 cut(s) 50
NmuCI GTSAC 1 cut(s) 80
PctI GAATGC 1 cut(s) 5
PkrI GCNGC 3 cut(s) 97, 100, 161
PspEI GGTNACC 1 cut(s) 131
PspPI GGNCC 1 cut(s) 212
PstI CTGCAG 1 cut(s) 100
RseI CAYNNNNRTG 2 cut(s) 147, 153
SatI GCNGC 3 cut(s) 96, 99, 160
Sau3AI GATC 1 cut(s) 145
Sau96I GGNCC 1 cut(s) 212
SetI ASST 4 cut(s) 69, 87, 91, 217
SfcI CTRYAG 1 cut(s) 96
SinI GGWCC 1 cut(s) 212
SmiMI CAYNNNNRTG 2 cut(s) 147, 153
SsiI CCGC 1 cut(s) 159
SspMI CTAG 2 cut(s) 86, 244
StyI CCWWGG 2 cut(s) 136, 163
TaaI ACNGT 1 cut(s) 131
TauI GCSGC 1 cut(s) 162
TscAI CASTG 1 cut(s) 130
TseFI GTSAC 1 cut(s) 80
TseI GCWGC 2 cut(s) 95, 98
Tsp45I GTSAC 1 cut(s) 80
TspGWI ACGGA 1 cut(s) 207
TspRI CASTG 1 cut(s) 130
VpaK11BI GGWCC 1 cut(s) 212
XagI CCTNNNNNAGG 1 cut(s) 89
XcmI CCANNNNNNNNNTGG 1 cut(s) 170
XspI CTAG 2 cut(s) 86, 244
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.