RchiOBHm_Chr3g0482901
ERF Family

Belongs to the class I-like SAM-binding methyltransferase superfamily. RNA M5U methyltransferase family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
28984861 .. 28985465
605 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ44771

Sequence Viewer

Length: 153 bp
ATGATTTTACTTGCATTGTTAGTTCAAAGGTATGTCCCTCTTGGAGCATCTGTTGCTGATTTGTATGCAGGAGCAAGTGTTATCAGATTATCATTGGCTGCTACAAGAAAATGCAGGCAAGAATTTAAGATTTCTGTAAATGCACAGTATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

50

Amino Acids

5.48

Weight (kDa)

9.86

Isoelectric Point (pI)

17.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000652)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 122
AgsI TTSAA 1 cut(s) 26
ApeKI GCWGC 1 cut(s) 98
ApoI RAATTY 1 cut(s) 122
BbvI GCAGC 1 cut(s) 85
BisI GCNGC 1 cut(s) 99
BlsI GCNGC 1 cut(s) 100
BmsI GCATC 1 cut(s) 56
BsaXI ACNNNNNCTCC 4 cut(s) 36, 63, 66, 93
BseXI GCAGC 1 cut(s) 85
BslFI GGGAC 1 cut(s) 20
BsmFI GGGAC 1 cut(s) 20
Bst4CI ACNGT 1 cut(s) 147
BstAPI GCANNNNNTGC 1 cut(s) 53
BstC8I GCNNGC 1 cut(s) 116
BstMWI GCNNNNNNNGC 1 cut(s) 53
BstV1I GCAGC 1 cut(s) 85
Cac8I GCNNGC 1 cut(s) 116
CviJI RGCY 1 cut(s) 98
CviKI_1 RGCY 1 cut(s) 98
FaiI YATR 2 cut(s) 33, 66
FaqI GGGAC 1 cut(s) 20
Fnu4HI GCNGC 1 cut(s) 99
Fsp4HI GCNGC 1 cut(s) 99
FspEI CC 7 cut(s) 13, 27, 50, 51, 54, 80, 100
GluI GCNGC 1 cut(s) 99
Hpy188I TCNGA 1 cut(s) 86
HpyCH4III ACNGT 1 cut(s) 147
HpyCH4V TGCA 4 cut(s) 14, 68, 114, 143
HpyF10VI GCNNNNNNNGC 1 cut(s) 53
LmnI GCTCC 2 cut(s) 44, 71
LpnPI CCDG 2 cut(s) 54, 100
Lsp1109I GCAGC 1 cut(s) 85
LweI GCATC 1 cut(s) 56
MluCI AATT 1 cut(s) 122
MnlI CCTC 1 cut(s) 48
MseI TTAA 2 cut(s) 126, 151
MwoI GCNNNNNNNGC 1 cut(s) 53
PkrI GCNGC 1 cut(s) 100
SaqAI TTAA 2 cut(s) 126, 151
SatI GCNGC 1 cut(s) 99
SetI ASST 1 cut(s) 32
SfaNI GCATC 1 cut(s) 56
SgeI CNNG 7 cut(s) 23, 53, 81, 87, 117, 127, 131
Sse9I AATT 1 cut(s) 122
TaaI ACNGT 1 cut(s) 147
TasI AATT 1 cut(s) 122
Tru1I TTAA 2 cut(s) 126, 151
Tru9I TTAA 2 cut(s) 126, 151
TseI GCWGC 1 cut(s) 98
XapI RAATTY 1 cut(s) 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.