Rmu_sc0003032.1_g000022
ERF Family

Belongs to the ABC transporter superfamily. ABCG family. PDR (TC 3.A.1.205) subfamily

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003032.1
OG0000652
Physical Location & Seq
Reverse (-)
84934 .. 85246
313 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003032.1_g000022.1.cds

Sequence Viewer

Length: 228 bp
atgtatgggcagaatgcaattgtagttaatgaattccttggcaagagttggtcacatgttcttccaaactcaaacgaatcattaggagttgaaattctgaaatctcatggatttcgtatgcatgcatattggtattggattggcgcaggagcattggctggatacatgctcttattcaacatttgttacactctggctctcacttatctaaaccgtgaagcaatctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
ABC2_membrane ABC_tran ABC_trans_N PDR_assoc

Protein Analysis

75

Amino Acids

8.53

Weight (kDa)

6.81

Isoelectric Point (pI)

29.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000652)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G18010 AT4G18010
fragaria_vesca FvH4_3g43741 FvH4_5g21310 FvH4_5g21310 FvH4_5g21310 FvH4_5g21310 FvH4_5g21310 FvH4_5g21310 FvH4_5g21310 FvH4_5g21310
malus_domestica MD06G1038900.v1.1 MD06G1039000.v1.1 MD06G1039100.v1.1
prunus_persica Prupe.5G044100_v2.0.a1 Prupe.5G044100_v2.0.a1 Prupe.5G044100_v2.0.a1
rosa_chinensis RchiOBHm_Chr1g0366181 RchiOBHm_Chr3g0482901 RchiOBHm_Chr3g0496141 RchiOBHm_Chr4g0424971 RchiOBHm_Chr5g0027221 RchiOBHm_Chr5g0059741 RchiOBHm_Chr7g0179331 RchiOBHm_Chr7g0187161 RchiOBHm_Chr7g0208651
rosa_laevigata RLG00000003205
rosa_multiflora Rmu_co8056148.1_g000001 Rmu_sc0000072.1_g000010 Rmu_sc0001758.1_g000030 Rmu_sc0003032.1_g000022 Rmu_sc0005406.1_g000008 Rmu_sc0008717.1_g000001 Rmu_sc0013772.1_g000009 Rmu_sc0025894.1_g000001
rosa_roxburghii Rroxscaffold_1G00001950 Rroxscaffold_1G00024950 Rroxscaffold_3G00250340 Rroxscaffold_3G00250350 Rroxscaffold_7G00169250 Rroxscaffold_7G00182410
rosa_rugosa Rorug05G0102000 Rorug05G0153100 Rorug05G0306800 Rorug05G0360900 Rorug06G0112500 Rorug07G0105200 Rorug07G0105200
rosa_samantha Rh1BG155200 Rh1CG036100 Rh1CG073400 Rh1DG080300 Rh1DG187100 Rh2BG453300 Rh3AG250800 Rh3AG258400 Rh3AG326800 Rh3DG236500 Rh4DG084600 Rh5BG330300 Rh5BG531100 Rh5CG555400 Rh5DG341500 Rh6AG492200 Rh6CG362800 Rh6DG217600 Rh7AG084500 Rh7AG163600 Rh7AG240200 Rh7AG467900 Rh7AG482100 Rh7BG235300 Rh7CG254900 Rh7DG086600 Rh7DG246200 Rh7DG333900
rosa_wichuraiana Rw7G020360

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 32, 93
AflIII ACRYGT 1 cut(s) 55
AgsI TTSAA 2 cut(s) 92, 178
ApoI RAATTY 2 cut(s) 32, 93
AspLEI GCGC 1 cut(s) 146
BciVI GTATCC 1 cut(s) 155
BfaI CTAG 1 cut(s) 226
BfuI GTATCC 1 cut(s) 155
BsaJI CCNNGG 1 cut(s) 37
BseDI CCNNGG 1 cut(s) 37
BsmI GAATGC 1 cut(s) 19
BssECI CCNNGG 1 cut(s) 37
BssT1I CCWWGG 1 cut(s) 37
Bst4CI ACNGT 1 cut(s) 215
BstC8I GCNNGC 1 cut(s) 123
BstHHI GCGC 1 cut(s) 146
BstNSI RCATGY 3 cut(s) 59, 125, 169
BsuI GTATCC 1 cut(s) 155
Cac8I GCNNGC 1 cut(s) 123
CfoI GCGC 1 cut(s) 146
CviAII CATG 4 cut(s) 56, 107, 122, 166
CviJI RGCY 2 cut(s) 158, 197
CviKI_1 RGCY 2 cut(s) 158, 197
Eco130I CCWWGG 1 cut(s) 37
EcoRI GAATTC 1 cut(s) 32
EcoT14I CCWWGG 1 cut(s) 37
EcoT22I ATGCAT 2 cut(s) 123, 127
ErhI CCWWGG 1 cut(s) 37
FaeI CATG 4 cut(s) 59, 110, 125, 169
FaiI YATR 7 cut(s) 6, 57, 108, 119, 123, 127, 167
FatI CATG 4 cut(s) 55, 106, 121, 165
FspBI CTAG 1 cut(s) 226
GlaI GCGC 1 cut(s) 145
HhaI GCGC 1 cut(s) 146
Hin1II CATG 4 cut(s) 59, 110, 125, 169
Hin6I GCGC 1 cut(s) 144
HinP1I GCGC 1 cut(s) 144
HinfI GANTC 1 cut(s) 77
Hpy188I TCNGA 1 cut(s) 99
HpyCH4III ACNGT 1 cut(s) 215
HpyCH4V TGCA 3 cut(s) 17, 121, 125
Hsp92II CATG 4 cut(s) 59, 110, 125, 169
HspAI GCGC 1 cut(s) 144
LmnI GCTCC 1 cut(s) 149
LpnPI CCDG 3 cut(s) 132, 144, 179
MaeI CTAG 1 cut(s) 226
MaeIII GTNAC 2 cut(s) 51, 185
MboII GAAGA 1 cut(s) 53
MfeI CAATTG 1 cut(s) 18
MluCI AATT 3 cut(s) 18, 32, 93
Mph1103I ATGCAT 2 cut(s) 123, 127
MseI TTAA 1 cut(s) 27
MunI CAATTG 1 cut(s) 18
Mva1269I GAATGC 1 cut(s) 19
NlaIII CATG 4 cut(s) 59, 110, 125, 169
NmuCI GTSAC 1 cut(s) 51
NsiI ATGCAT 2 cut(s) 123, 127
NspI RCATGY 3 cut(s) 59, 125, 169
PaeI GCATGC 1 cut(s) 125
PciI ACATGT 1 cut(s) 55
PctI GAATGC 1 cut(s) 19
PfeI GAWTC 1 cut(s) 77
PscI ACATGT 1 cut(s) 55
SaqAI TTAA 1 cut(s) 27
SgeI CNNG 9 cut(s) 50, 55, 68, 119, 134, 159, 171, 178, 206
SphI GCATGC 1 cut(s) 125
Sse9I AATT 3 cut(s) 18, 32, 93
SspMI CTAG 1 cut(s) 226
StyI CCWWGG 1 cut(s) 37
TaaI ACNGT 1 cut(s) 215
TasI AATT 3 cut(s) 18, 32, 93
TfiI GAWTC 1 cut(s) 77
Tru1I TTAA 1 cut(s) 27
Tru9I TTAA 1 cut(s) 27
TseFI GTSAC 1 cut(s) 51
Tsp45I GTSAC 1 cut(s) 51
TspDTI ATGAA 1 cut(s) 45
XapI RAATTY 2 cut(s) 32, 93
XceI RCATGY 3 cut(s) 59, 125, 169
XspI CTAG 1 cut(s) 226
Zsp2I ATGCAT 2 cut(s) 123, 127
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.